Description :
From Genome Similarity Track
Location :
Scaffold_9:42375- 43999
Transcript NameFunction/comments
Phypl_g406phospholipase D-like protein

Sequence
1624 bases(100 bases per row)
CGTCCTGCCTGCACTGCGTTTCAACGCCATTGACCTCCATGACGACAGCGAGCTTGAGTCGATCGATCCCGTTCCTGCCAGACCCACAGCAACGCGCCAA
TGTGCTGGAAAaaagcgagcgagcgccgTTCGAGCAGCCTGTTCTCGAGCCGGCCAAGTGGTTCCTCtcggccaaggagctgcggaCTGCGCGGGACGGC
TTCGAGAGACCGAACCTCGCGCTGTTTACAACGGGGAACCACGCCAAGATTTACGCTGCGACGGCCGAGTACTTCAGCGACGTGGCGGACGACATCGCGC
AGACTCGGGAGCACGACCTCGTGTACGTGACTGGCTGGTCGGTGTGCAACGTACCGTTCAAGCCGCTTGAAGCGGCTTCGACGCtgcacgaactgctgca
AGGCGCGGTGACGCACGGGGCTGACGTCCGCATGCTCATCTGGTCGAATTTGACGGAGAGGAAGCAGGTTCTCGAGGTCCGGGACTTTGTCAatgcgctg
ccgccgccgaagGCGAGAGGTCCCGcccgcttcgtcttcgacgaccGACTGCCgcacagcacgtcgtcgcaTCACCAGAAGTCGGTCGTGGTGCGCAAAG
GCCGAGAGCTTGTTGCGTACGTGGGCGGGGTGGACCTCACGTCGAATCGATGGGATACCCTCGAGCACGACAAGCACGaactgcggcggcgcgtggGCAT
CGAGAGAAAGGGTCGCAAAGGGTGGATCGACGCGCACGCGCGGATCCTTGGGCCTGCAGCGAAGGATGTGGCCACGAACTTTCTCGCGCGGTGGAACTCG
GAGCCGAAGCCGTcgcaggatctgctggacgacgtgcttgCTTTCGAGAACCCGGAGTTTTCGACGCTTCCTCCCGTTGAAGAGAGTGATCCACCACCAG
TGATTCCTGAAGATGGCTCTCATGCCGTGCAGTTCGTGTGCACGTACAGCCCAGACTACGACGGGTACACCGACTTCGCGCCGATGGGCGAGCAGTCGAT
CCTCCATGCCCGGATCAAAGCAATTCGAAACGCACGGAACTACATTTTCATCCAGGACCAGTACTTTATCCTGGTAcccgagcttctcgatgttcttctt
gaagtcCTGCCAACCATCACGCGCCTAGTGGTTATCGTGCAGAGCACCGCCGAAGCGAGTTATACGGGCTACGACAAGTATCTGTACGACATGGTCTccc
cgctgcagcttcattTTCCCGACAAATTCCAGTTCTACACAACGAAAGAGTCGCGCGGCTTGTACATCCACAGCAAGGTCGTGATCGTTGACGACGTCTA
TGTCTCGCTTGGCTCTGCGAATTGGAACCGGCGTAGTATGACGAGCGACACGGAACTTGGCGTCAATATCGTCGACACGGATCGCATTCAGTCGCCAGAC
AACGTCACTGTCAACAAACTTGCTCGCGACTTTCGTCTACGGAAATTCGTCGAGGCAACAAAACTTCCGTACGAGAAGTTGGACGCTATGACTTTTGTCG
AGGGGTGCGACGCACTCCAGAGTGCTGCACTCGACGATGGGTTTAGTCTCATTCAACCTTACACTCTCCAAGACAAACCTAGATTCGACGTCAACCATGT
CCAGCGACGGATTGTTGACCCGGA