Description :
From Genome Similarity Track
Location :
Scaffold_74:42350- 45103
Sequence
2753 bases(100 bases per row)
CGGATCCCTTCTACCCTGTGGTGAAGAAATACGGAGACGTTGTGTCGAAAGACCCACCGACGGGCCTGTCGCCGGATCGAGGCGTGTGTCATGAGATTGA
CCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGACCTTTGTCGAAAGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAATCACGAGGCA
GGGATGGTGCGTACGAGTAAGTCTCCGCACTGGACACCCACGTTCTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAA
ATGCGGCCACTATCTCGGCGCAAACGCCGATACCTCGCAAGGATGTTCTGCAGAACAACATGGTAGCCTGTACGTCGTACAGCGCGCTCGACTTGGTCGA
TGGCTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTGATGCCCCAGGGG
CTGTCGAACCCACCAGCAACGTTCAATCGTCTTGTGACGCAGTTGTTTAGTCCCCACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCCATA
GTCGTGCTGAGCACGGAAAGTCAGACGTGGAAACCACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTGGAT
AAGTGCGTCTTTGGCGCGGAGGAAATACCTTTCCTCGGGTGTTTCATTGGGAAGCGCGGCTTAAGGGCAGAGCCTGCCAAAGTCAAGGCCATCGTGGACT
GGCCGGTTCCCAAGAACCAAAAGTACTTACGCTAGTGGCTAAGCTTAGCCAATTACTTGCACAAGTACAGCGCAAACTACGCGGAGATGGCTCGGCCATT
ATCAGATCCCCTTAAGAAGGACGCACCATGGTCCTGGAACGTCGAGCACGACGGAGCCTTTGAGGCTGTAAACAAGAGCCTTCTCCAGTCTCCGATCCTT
GCGCTACCGGACCTGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTTGCAATCGGTTGTGCGTTACTACAAGCAGACGCCGAAGGGCGTGAAC
GCGTGATCGCGTTCGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATT
CAGGGTACACCTGCTAGGCTCTAAGCCTTTTGGGATCTTCTCTGATCATGCGTCGTTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCA
AGATGGCTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAAGCCGGGGCGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACG
AGTTAGCTCATGCCACGACAGTGACGTCGTCAGTGCCTGACTTGATACGCGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGG
AAGCGAAGAGTTTAAAGACTCTGACAAGGAATTGTCTGGGCGCTTACGCGCGAGGCTGCATCGATACTCGCTCGATGGCGGCCTGCTGTACTACAGCACC
GACTCTGAGGATAACCCTTGTGTAGTCGTTCCTCATGATGAGGATCATAAGTATCGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCGCTTAG
GTCGGGAGAAGACCTACGGCTCGGTGAGCACGATGTACTGGTGGCCCAAGATGTATAAGTGGGTCGGCACCTATGTACGTACGTGTGAGACGTGTCAACG
GACGAAGTCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCCAAGGGATGTTGGCAGTCCATGAGTATGGACTTTGTGTTTGGCCTTTCC
AAGGACAAGGCAGGAAACACGGGTATTGTGGTCTTTGTAGACCGATTGAGCAAGATGGCTCATCTAGCGGGGGTGCCGGACACCATAGATGGTGAAGGTA
CAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAATTGTCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGGACGT
CCCTATTCAGAGTGCTTGGCACTCGTTTGGACATGTCCACAGCGGACCATCCGCAGACCGATGGTCAAACCCGAACGCGTGAATTGCGTTGTGGAGGATA
TCCTCCGAAGCGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCACTCGTTGAGTTCGCATTAAATAATGCAGTACACGCCTCGACAGGGTA
CACTCCGTTCTATGTGAACGGCTTGGTTAACCCTCGCGTCCCACTGACGCCGCCACGCAGTGGCTCAGGGCTTGATGGGGGAGGGATAGCCGAGCGGCTA
GCTGATATCAGCCCTGTTGCGGTTCGCAAGCAAGTCAATGACTTTGTCTCTTTGAGACTAAGCGTAATGCGTCAAGTACGCGACGCTATGACTGAAAGCC
AAGATATGCAAAAAGAACATGCAGATGCCAAAGGCAGACGCAATGAAGAAAGGTTTGAGGTCGGAGACCAAGTTTTATTAAATGCAAAAAACCTACCTAC
TCATGCAGTGTCTGCAGTCTTTAAGACAAAATTGAGACCACGGTTCATAGGACCGTTCAAGGTCGTGGCCAAGAAGGGCCTAGCGTATACGCTTAACCTT
CCGAAGAATATGCGCACGCATCCAGTCTTCTACGTTGGCTTACTCAAGTAGTA