Description :
From Genome Similarity Track
Location :
Scaffold_135:4235- 7892
Transcript NameFunction/comments
Physo_143308reverse transcriptase

Sequence
3657 bases(100 bases per row)
TGTCGGCCTCTCCACGCGATTGCATCACATGGAACCTCTGCCGGCTCCGACGCTTCTGCTGGAAGTCGAACAGCAGACCACCACAGTTCAGGTATTCTTC
CTTGACCCAATTCGTCTCTGCGTGGCCCTTCCAACGCACCAAATATTCCTTGAGCCGTCGACCGTAGCGTGTGCGTCTTTCCGTCTTTACATCCAAGATC
TCTTCAACTTCATACTCGTTGTCACCGCGAGTTTGTGCCTCCCAGCTATCCTCGGGGAGAAGTTCTTCGTCAAAGTCAAATCGTTCGCTTTCATCAACAG
TGCGATCTTCGGCGGGTCGTTCGGGGAACTGTCGGACCAGCTTCAGCTTCGAGATGTGTACGATAGGGAACAGTCGGTAGTCAGTCCCGCTGATTTCCAG
CTTGGCAGCGTAGTCGCTTACCATGGTGGCGACTTTGAAAGGCCCATGCCACATGTGAGCGAGCTTCCGAGCGTATCCGACCTTGACTCGGTCGAGGTAC
AGTCACACCTGCGATCCCTCCTTAATGGGTGACTCCGGTACGTTCTCATTGTGGGCTTCCGCGCGACTCTCACGAGCTTCGGCGAGGAGACGACGAGTCT
CTGTCTGAGCACGTTGGTATTGGCGTTGGATCTTGAACCTCCATTTCTGTGGGTCGAGATCTCGGCTTCCGGTCCCTCCGGCTTCGTTGTGCCTTTGCCA
CAACGAAGCCGGTGAAGAGATCCACGAAGACTAGGAGCTCTGTGTTGCCCTTGAACGACTACCGGCTTCGTTGTGCCTTTGCCACAACGAAGCCGGTGAA
GAGATCCACGAAGACTAGGAGCTCTGTGTTGCCCTTGAACGACTTCGGGAGGGTGGGGATATGATCCATAGCCACGACCTGGAAAGGGTAATTAGCGGCG
ATATTGCCCGGCGATCGCCCCCGCAAGGTGGGTTTTCCTTTTCCCGTCTCGCAGTCGACGCACTCCCCGACATACTTCTGCACACTTCGGAACATACCTC
GCCAGTAGAAATGCCTCCGAAGCTTTTGGAATGTTTGGCTGACTCCCTGATGACCTCCCTCCACACTTGTGTGGAAATGATGCAGGAGATCTTCGTGGGG
TGTACTCGGCATTACCAGTTTCACCATAGATCCACGGTCCTCGACATCACCACCGCGCCCCTCGACTGGACAGTACATCAAGAGGCCATGCTCGTCGACC
TCGTAACTGTTAGCCAGTTTACTGCACGTCTTGGCTTGACGGCTCGAGATCTGAGAGAGATCACCGTGCAGGAAACGCTTCAGTGACCAGATCCACACCT
CCTCGTCTTGAGCACGGCAAATACGTTCCAAGCGCAGCTGCTTGACGACGTCTTCCTGCAACACGGCTGGTGCGACAGTACGAGATCGGCTTCGCGTGAC
AGCGCCTACCTTCGGATGGGCGTCACGTTCTTCGCGCGTCTTGAGGAGCTCGTCCAGTCGATTCAAGGTCTCGAGGTCCGTGCAATCGGTGTGACTCTCG
ACAACTACCCCGGCACCACGCGTGCAGCGCCTGTCCCGCCAGCATATCCGCGGGTTGGTTCCAATCGCGTTTTACGTGGATGAGTTCGCATTGCGGCCAA
GACCGCAAAATCACTCTGGCCTTCTCACGCAAGAGCTGGAGTCCCGATGACTTGCACTCCATCTCTCCACGGAGTTGGCGGATGACTAAATTGGAGTCGC
CACACAGAATGAGACGGTCGATCTGGAGATCGGCAATCAAACGAAGTCCGAGAAGGAGGCCATGGTACCCGGCCTTGTTCACAGTGTGGTCCGGTAAATA
GCCAGATTCAGCCTTGACAACCTTCCATCCAGGAGCATCCCATACCACAGCGCTGAAAGCTCCACCAACTCGTTTCGGCTTGGCCGATCCGTCAAAGCTG
ACGACGCAAACGTTTTCTCCGGGCGTAAAAGTCGGCATCGGGATAGCCAATGCTCTCGTCGACTTCTTCTGCGGAGAGATCTCCTCCAACGCTGCATCCA
TCTCTGCGCGCGGAGTGATACTGGCGGCAACCAAACCTAGTAGCTCATCTTCGCCTTTCGTTAAACGTTCGATCTCTAGCGAATGGGGGGAGAGCAGCGC
CGCCCACTGAGCTAGCCGTCCCTTCAAGCCTTTCGCGCGGAAGAGCCATGCGAGAGTCGTGTGTCTGGTGAGCACTCGGATGTATCGACCACTCAGCATG
GTGAAGCAGCTATCGAGGGTTCTTAGCAGAGCCAGTACTTCCTTCTCCACAATGTCGTACCCGATATCGTGAGACCGCAGTGTCCTACTCGTAAATTTGA
CGGGTACGTACACTCCATCACGACACTGAACGAGAGAGGCAGAGATCGCCCACTTGCTTGCGTACACAATCACAACAGGATCCAACTCTGGGGCAAAATG
GTAGAGCATGGGTGCGTTGATCATCTTGAACTTCAGGGTATCGAAGGCTCGTAGCGCGTGGCCCCATCTCACAGTCGCCTCGTGATTTCCGCTGACGTTT
GTGGCTCGACCCTTGATGAAATCGGAATCTCCGAACTCATACAACACTGTGGCATATACTGCGAAATCTTCGATGAAGCGATTGTAGTAGTTGAGACTGC
CGAGGAATGACTGGAGAGCCTTAAGCGTTTTGGGAAACTTCAACGCCCCCAGACTTGCCAAATCTTTCGGCTTGGTGAACAGGCCTTCACCGGAGATCTG
ATGCCCCAGATAGTCGACTTTGCTCATACCCCAACTGCTCTTCTCCGCGCTAATAGACATATTCCAGCGGTCACAAACCTCGAGGATCTTCTTGACCTTC
TCACACAGTTCGTCCCACGAGCTTGCTCCAACTAAGATGTCATCGATGTAAGAGCGACGCCCCAGCACCGACGGCAGCGATCGATCTTCAGGAACACCGT
CCTCGAAAATGTTGACGAGATCCGCGCGATCTTGACCCGGCGAGATCCGCAGCACGCCATATAACGCATTGTCGATCAGCCGCTGATAGATTTGGGGGGC
ATTCTTCAGACCAAACGGCATTCGCAGCCATTCGAACAGGCCGAACGGCGTAATGAACGCGGAGATCTCTCGGGCTCGATCGGTCATACTCACCACCCAG
AATCCACTCGCTATGTCGAGAGAACAGAACCACAGCAAACTGTCGAGATCATCGAGGAGGTCGTCAATCAACGGCATGGGGTAGATCATCAGTCGTGTCA
GAGCATTGACCAGACGGTAGTCGATAAAGAGTCGGACGTCCATGCCGTTCTTCTTGACGACAATAACGATCGGAGACACCCAAGGAGAAGTGGAGATCCG
AATAATCTTCGCCCCCAGTAGCCCCTTGACGAGTTGGAACACCTTTTCACGGAACTGAGGCGGGATCCGGCGACAACGCTGAGCCACCGGTCGTGCACCA
CCAACGTCGATGTCACAGATCGCTCCCGTCGCCGCAGGGGGTAAAGCATTCCCTTTGCCGATGAGAAGGTGACGCCGCTCCCAAATGATATCACGCAGAC
GATCAATCTCCTCTGCTGTGTTCTCAGTTGGATCCCTGACCTTGAGATCTTCCCTTTTAACTTCTGCCGTCAGGGAGATCTCTGGTAACACCGTCATCTC
CTTTTCGATGTCTTCCGCAGTGAGATCGGCCCCTTCATGAACATACTTCGCTTCATC