Description :
From Genome Similarity Track
Location :
Scaffold_267:42341- 43894
Transcript NameFunction/comments
Phyta_totarag6454Transposable element Tc3 transposase putative

Sequence
1553 bases(100 bases per row)
agtacaCTCCGCGACAGAATAGATCACCCGGGGTGGTTTGTGCCCGTAACTCGGTCAATAGTTAGAGTTAGCCGGCGCTGTTTAGGTGTGCGCTTTCTGT
CATTGGTAGTAATACGGTGTTTGTGCTAACGAGCGCAATTTCGCAGCCTGCGGGGGACCTCCCATACAACTTACCGCTTTTGGCATCGCGACACAATAGA
TCACCCACAACCCCAATACAAAAAGCAAGTATAAAGAATGAGGGTCAAATCAGTAGTGAGTCTTGTTACCCTTCTTGTCTAACACTTCTACGCAGCGGCG
AGGCATGGCCTCGATGAGGGACTGTAACAAGGCTAAGGGGATGTCACCCTATGCCTTGAAAAGTGCCGCCTTCAACTCAGGCACGCTATTGAACTGTTTC
CCATTAGAATAGACATTCCTACTCATGATCGACCATAAGTTCTCAATAGGATTGAGGTCGGGCGACTTAGAGGGCCAATCTAGAACAGTCACCTCTTGCT
CCTTAAAGAACTCCTTGGAACGGTGGGAGACATGGATGCTAGCATTATCTTGTTGGTAGATAAAGTCAGTGCCGTAGTTCAGGTGCGCGAAGGGGAGGAA
ATACTCGGAAACAGTATATACGTAATCGTCTGAGTTCTGCCTCCCCGTCAGTACGACAAGCGGAGACTAGCCGCGGGCGCTAAAAGCCGCCCACACCATA
ACAGAGCCGCCAACCGCCTGGCGCCTCTTGGTGTAGCGTGGTGGCCTGCGGACGTCCCGCCAGTAATGCTGGAAGCCGTCGGGGCCGTCCAGgttccact
tcttctcgtcaGAGAAGATGATGGATTCCCATACAGCCCCAGCGTCTTTCCTCAGCAGCATGGCCCCCGCCCATGCCTTCCGCGCCAGCAAGCCTTCCGG
CTTCAGTGGCAGGGTGTGCACCGTAACGGAGAGGCCCAACTcttccttgagcttggcggCGGAGGAATCGCCCTTTGCGGCGGTGCGGATGAGGCGGCGG
GTCTCGCGGTCGGAGAGGGAGGGGGCACGGCCAGGAGGCTTGGCGTCGTTGACGGGCGGGGCGGGGACTTTGGACGAGGCCACCACGCGCCTCACGGTCT
GCGCGCAATGGTCCGTCCTCCTGGTGATGGCACGAGCGCTGAGGCCGGCCTCGTGGTGTCCCTCGATCTTGCCACGCTCGCGGTCGGTCAGGCggggctt
cttctccttgggcggcggcttcttcttggtcagcatCCTGCAGAATGAAGCCGCTGCTCGCTGCATTCCCCGCCGCCGCACGTGGCTGCACGCCATTTAT
TTTGGTATTGACCCTCATTCTTTATACTTGCTTTTTGTATTGGGGTTGTGGGTGATCTATTGTGTCGCGATGCCAAAAGCGGTAAGTTGTATGGGAGGTC
CCCCGCAGACTGCGAAATTGCGCTCGTTAGCACAAACACCGTATTACTACCAATGACAGAAAGCGCACACCTAAACAGCGCCGGCTAACTCTAACTATTG
ACCGAGTTACGGGCACAAACCACCCCGGGTGATCTATTCTGTCGCGGAGTGTA