Description :
From Genome Similarity Track
Location :
Scaffold_228:4234- 9805
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_228-fgenesh-gene-0.0Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_228-fgenesh-gene-0.1Type I inositol-3,4-bisphosphate 4-phosphatase

Sequence
5571 bases(100 bases per row)
ATCCGCCAAGAGGCTATTGAGAACCTGCGACGGAAGCTCGAGAAGGAAGGCGTCGCCAACTCAACTGCCATGCTGCATCCAAATGCCACCAGTCTCCGCG
GTGCGAGCGCCAAGCGTCTTCTGCAAGTGAAGCTTCCTCAAGGAGGCAACATGTCGCCGCTGCCAAACGCGCAGCAACTGCACCTCATGTCACCCACCGG
GAGCCAGTCTTGGAGCGTACAGTCCATCGACGACACGGAATCCGACGACGACGCGGACGTTGAGATGATGGATGCTCGTCCTTCTTTTTTGGAGTCAACG
TCGTCGCAGTGCCAGCAATCACTGCCGCTCCTTACTCCACAGCCAACGCACAGCGGATTCAACCTTGAGATCCCAAGCATCAGTCCAAAGAAACCGTTTT
CGATCGGTCAGCAAGCCGCTGCTGCTCACTTCCAGTACGACCAGCGTGACGGCGCCTGGGTTCAAAAGATGCCGCACTTAAGCCAGCCCCCGAACCGAGC
CATCAGTCCATTCCAACACAACCACCACACCAAGGCTTCTGCTTCTGGTCCGACCTTCAGCATGCCGTCGCTTAACCTTCTCGTCGACGCGTCCATCTTG
ACTGCGTTCAAGCACGATGCCCACACCCAGCAGCACCACAACCAGTTTGCTCCACAGCAGCAGCAACAACAACAGCAGCAGCAGCCACAATGTCCACGCA
TGTCGATGCGCGACATCCTCTCGCACACTGCCATGGCGGCATGAGGGAGATCTTCACCAACCCAACCTATCGCCCCAACGTCCAAGAAGCCGTATCGTGT
CGTATCGTCCATTTGTTGATAGAGCAGTCCGTTTACCATTTTCCCGCCAATCTTGAGTCTCGAGTCATCCTTTCTCTTCTTCTCCACTCGTGTCTTCTAT
CGCCCGCATGTGTGCTCGTAAAACTAATAGCAGCATCAAATCAATTTTCAAAATCAGCAACAAATAACATGGAAAATACCTGCATCTTTATTGTTGTTTG
ATAAAATAAGGGTTGGTCTTCTTCTTCGCTGGATGGATGATGTTGATGGGTAGACGCGATCTTGGACTTGATCTTGACTTGGCAGACGTCCTGGTCACGA
AAACGAGTGACTGCCACCTCCAGTTCCCGGCGGACACTTGTAGTCGTGCGGGAGCATGTAGTTCTGCAGCGCACTGAAACAGTACTGCGCTTTCCCGATG
TTCTTGCGCGCATTCTCTCGCCGAACACCGTACGTGCGCAGCAGACTCGTAAACAGGTCCCGTTCGTCAGAGTTGAGGCCGTGAGAAAGCACCAGCAGGT
TTGCTTCTTCCAGAGTGATCGACATTGCAGTGCGGTCTTTTGCTGATTTGCAGCAGGTAACTCGTCCACCGCCAATCGAGCGCACAATCAAAGACGATAA
GCTCAAGATCGCCATGCGCTTCGACCGCCCCGAGAGCTGGATGTTCGTCTTCAGTCGATCCATCAGTAGCTGCAGTCGAACTAAGTCGTCAGGGGTGTAC
ACAGGAGGCACTGGCTCAGCCGAGCGGTCGCTGTTACACGCGCGCTTCTTGCACCACTGCACAAATGAGACGTAGTATTTTTCCAGTACGATGACGTTCT
CCGCATTGATCTCTTTCTGCAGCGCGTCCTTTCCGACCGTGTTTGCAACAGTCTGCATTTCGTTCATCCCCTGCGAAAACAAAACGGACTTCACGCTGAT
CGTCTTCCGGAACACACGCTTTGCTCGGTCAATTTGCTCGTTCGAGGTGAGAGGGCAATAGACAGCGCCTGTGAATGCATCCTGACCGGGGACGCGATGC
ATGTTACGATCTGGAAAATCGTTCGGGTCGCACACAATGATCGGCAGCTCGATCACGATGCCAAGAGGGCCCGACGTGACGGATACGCGAAAGTCTGCTT
CGCGCGGAGTCTGCACCGGTCGCAACTTGATCAGCACGCGAGATAGCTCCTTCACTGCAGCTTCCATGTCGCCCAACATCCCTGCTTCGTTGCTGTACGT
CGAAAGCAAACTCTCGACCGAGAACAGGAAGCCGACCTGTGACACCATCTCCAAATACTCAATACTACGAAGCTGCATCCTGTGGGAACCAAATTCCTCA
TCGTCGTGGATGTGGGTGTACATCGTCTGCTGGAAGCACGTCACCAGAGCGCTCATCGCCTGGCAAAAAGCAACTTCAAGACGACGCTCGACGTGCCACT
TGAGCTCGTGGTACTTCCTCTCCAGGGCCTCGAGCGTGAGATCTGAGCTTGATTTCTCTGCCTCTCGAACGAGTTCCACGTGGATTCTCTCCAGCTCCTC
ACGCATCTGACGAATACCGCCGTTCTTGAAACCATACACGTGTGCAGCAAACGCCCCCACCGTGGTCGTTCCGTACATGCTGTGATGCTGGAACGGAGTG
TGCGTTTTCGCGTGCTTCTCGTCGAGGTGGTGGCGCGTCTCTTCCACTTCGCGCCACTTACCCTTCATCCATTCTGCGAACCCATGGAGCTTCTGCCCGT
TGCTATTCGCATTGCGAGGAACGCTGGGTTGCTCCTCACCATTCGTCTGCAATCCATGCAAGTCTCTCTCCGACATCCCAAGCGCAACGATAGTCTCGGC
AAGCTTGCGCTGTTCATCGGTCACCGAGACTTCGCGACCGGACGCACTCATGTTCACGATGTTCTCTGCGGAATCAAACGAAATCACTCGGCGACGCAAC
GCTTCAACAGGCTCGACAGGAGACTCGTCATTCTCTCGATCGCCTTGACCGTCGGTATCATGCACAGCGTCAATGCTGTCACTCTCGCCATCGCTGTCTG
CGCTGCCATCAACGTGGTTGTGGTTCTCGTTGTCCAAGTCATGAATCGTAGCGATGTGGTCTTCCGCCGACTCGCGTAGTTTATGGGATGGAGACGCCAA
GATTGTCCCGACAAACGTATCCACAAGTCGAGCATATCGCACGCCACTGCTCGCATTGTCCCCATAGATCACATCACTCGGAGACGTCGGTACAGCTGTC
CCCACGGTCATGAGCTGCTGGTGCAGGTTCAGTGCCAGGAAGCTAAGGTTCGCGTCAGCTTTCATTGTGCTCGGCTTGAACGTTAGTCCGCCATGCTGGG
TGTCGCCATAGCGCAAAATAGCATCCTCGACCTGCGAAATGTACTGCTCCATGGTGATGATCAGCTCGTGGCGCCACTTCTTCTTCTTTCTCTCCATCGC
ATCATCCTGGATCTGGTAGATCAACTCCGATAGCATGCCAATACTTGGTGTTGATCTTCTTTTCTGATCTGGCAACGATCCGGTTCCTTCTGCAAGTTCG
TGTGAGAGAGGCGCGGCGAAGCCGCCACCAGTTTCGTCATCCGATGACACAAAACCTTCATCGCCTTCGCTTTCTGGAACAACACTGAGAGCCCCCGGCG
ATGTTGACAGCGGCGGCGGCATGGCTGACATGCCAAAGCTGGAGATCTGGCTGATGGGCGTTGACGACAGACTTCCGCCAGCATCACCAGACAAATTCTC
TCGTTTCAGTGCTTCAAGCTTGACAACCAAATCCGATAGAATGAGCTGCAGAAGCTGATATGGGATCTCCCAGGTGTAGACACTCTCGATCAGTTCTTCT
TCGACGAGTACTTTGGCGTGACTGTGCTGTAACGGGTCACTCTTACGTCGAAGAAAAAACGCCGGTGGCTTGTCTTCCAGGAGCGTGTTCGCGTGAACTT
CGTCGCTTTCTTCAGCTGAGAAATACATGAACGAGCGCGTGATGCGCTGGCGACCTTCATCTAAGACCCCACTCGCGCTTTTCACTTCAGCTTCGCAGCG
AACGACGATCTCTCCCGACGAGCGAGAGCGCGAGAGCGGCGAAAACAGCGCATGGAGCGTCGCTCGCCCGAACGCGAACTTCGACGCCTCCATGAACGAC
ACCAGCGGGATCAGCGCATCGCCGACGAGCCACTGGCTGTTCAGATCATTGATTGACTGCACATTGCGGATCGAGTAGACCGAGATGCGCAACAAATCCT
GCTCACGCATCTCCACCGGGAGCATGAGATGGAAGCACGGATCTTCAGATGCAGACACCTCGGAGCGACCGATTTCTACGATTACATCCCCTGTGTCTGC
ATCGAGCACATGCAGCACCAGAAACGATGACGCAGTTGCAGAGGATGACGGAAGATTTAGATTAAAGCACTGGAAAGAGAGCCACGCGTATGCGGTCTTC
GATGCGTCGTCCATACTTGCGACAGGCTCACTGGACAGCATCCCAGCATATGCAGACGCTGATCGTTTCTTCTTCTGTCCCCGTTTCGCAGATCTCTCGA
GCACATTGCCTGACGAACTCACGAGACGAGCCTCGTGCAATGGTGGCGCATGCATGTGATCACGAGCAGCAGAAGGGGCTTCACTTGCTCCATTTGAGTC
TCCTTGCTTTTGCGCGACCAGCTCTAGCCGTCGCCTCGCCTGTTCCAACACATTTCCGCCGAGACCGGACGACAGCGGACTGGATCGTCGACTTGAGATC
CGGTACCCGCCGCGAGCTGCTAAAGCTCCGCCGACAATGCCACTTGCGGTCGCGGGCGAGCTCGATGATAGCCCCATCGAATTACCTGCACCTGGCGTGC
CGCTGTGCGGCAACTTGGTCGTGATGGACAATGGAGGCGGCTGGTCGTCGTACAGCAGCGGCGTCGACTCAGACGTCAGTCCATTGAAACTCGGGCGTCT
CCGCGACGGGAACTGCATGTCTGGCTCGACCTCCCACATAAGCACAAGGAAGAGCACGCACGGCACGACCTCGGGGATCGCATACCCGATGATGATGCAC
ACGTTCGGGTCCCGGATGTCGCCGCAGCCTCGATGCGAAAACGGTCGCTGGAGGTAGAGCAGTGTGCGCAACAGGAAGATCACGGAGCAGACCACCATCA
CGAGGATCGTGAAGCGCAGCGCGCGGTGCAGCTTCGCCTCGACGCGCTCGTCCAGCCGCCGGCGCTGGCCGTCGCCCGACTGCTTCAGCACGCGTCCCAC
TCGACGCCGCATCTTGCACGTCGAGTAGACGAGCCCCAGGGAGCTCGCGAGACTGCCTGCCGCGATCAAAAACACGGGGAGCACACCCGTGAGCAGCTCC
GAGTGCGACTGCGGGTCCTGGTCCTCCGGCTCCCACTTGTCGTAGCTGTACATGTGCCATACGTGCACGACCGAGAGACCGAGTACGAGCGCGTAGAAGA
CGCCGTTCGCGAGCACAAACGCGTACCAGATGCGCTTCGAGCGGCTCGAGATCTTGGGGTTCGCGATGTCGATCCAGAAGAGCACCTGGAAGAGCACAAG
CGAGAAGAAGAAGCAGAGTGCCGCGCGGTTCAGCAGGTCGCGCGCCACGTTCTTCGTCAGGAACGAAATCGTTCGCGTGAGCGCAAACATGACCATCAGA
CGCTGGAACGTGTGGCGCCGCTTCACCTCGTAGGCCGAGAAGCGTGTGGGCAGCGACATCGCCTTGCACGCCGCGACGATCGCCAGCGCCAAGTAGATCG
ACACGCAGAGCATCTCGACGGGGAGTGCCGGCTGCGGCAGGAACACGAGGCCGTCGTCCGGGTCCGCGTCG