Description :
From Genome Similarity Track
Location :
Scaffold_21:4234- 31862
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G008298Similar to CDC48: Cell division cycle protein 48 homolog (Glycine max)
Pytul_DAOMBR144PYU1_G008297Protein of unknown function
Pytul_DAOMBR144PYU1_G008295Vacuolar protein sorting-associated protein 15
Pytul_DAOMBR144PYU1_G008293Similar to nol12: Nucleolar protein 12 (Danio rerio)
Pytul_DAOMBR144PYU1_G008292Similar to Gbp4: Guanylate-binding protein 4 (Mus musculus)
Pytul_DAOMBR144PYU1_G008291Similar to nuo-12.3: NADH-ubiquinone oxidoreductase 12 kDa subunit%2C mitochondrial (Neurospora crassa)
Pytul_DAOMBR144PYU1_G008290Similar to CENPJ: Centromere protein J (Pan troglodytes)
Pytul_DAOMBR144PYU1_G008289Similar to Sphk2: Sphingosine kinase 2 (Mus musculus)
Pytul_DAOMBR144PYU1_G008288Similar to SPHK2: Sphingosine kinase 2 (Homo sapiens)

Sequence
27628 bases(100 bases per row)
TGTGCGCCGTGAAGACGAAGAGAAGATGGATGACGTTGGCTACGACGACATTGGCGGTTGCCGTCGTCAGATGGCGATGATCCGCGAAATGATCGAATTG
CCGCTTCGCCACCCGACCCTTTTCAAGACCTTGGGTGTGAAGCCACCACGTGGTGTGCTGCTCTACGGCCCTCCTGGTTCGGGTAAGACGCTGATCGCGC
GTGCGGTCGCAAACGAAACGGGTGCGTTCTTCTTCCTAATCAACGGTCCAGAGATCATGTCGAAGATGGCTGGTGAGTCAGAAAGCAACTTGCGCAAGGC
CTTCGAAGAAGCCGAGAAGAACGCGCCTGCGATCATTTTCATTGATGAAATCGACTCGATTGCGCCAAAGCGTGAAAAGACGAATGGTGAAGTGGAACGT
CGCATTGTGTCGCAGTTGCTGACGCTCATGGATGGTCTTAAGCAGCGCTCGAGCGTCGTTGTCATTGGCGCCACGAACCGTCCAAACAGCATGGACCCAG
CACTTCGTCGTTTCGGTCGTTTCGACCGTGAAATCGATATTGGTGTGCCAGACGAGAATGGTCGTCTTGAGGTGTTCCGCATCCACACCCGCAACATGAA
GTTGGATGACGATGTGGACCCTGAAGCGATCGCGCGCGACACGCAAGGTTTCGTCGGTGCGGATATGGCGGCGCTGTGTACCGAGGCTGCGTTGCAGTGC
ATTCGTGAGAAGATGGACGTGATCGATATTGAAGACGAGTCGATTGATGCGGAGATCTTGAACTCGATGTCGGTCACCCAAGCCCACTTCAAGTACGCGC
TGGGCGTGTCGAACCCATCGTCGCTCCGTGAAACCACTGTAGAAGTACCAAACACGAGCTGGAAGGATATCGGCGGTCTCGAGGACGTCAAGCGCGAGCT
GCGTGAGCTTGTACAGTACCCAGTGGAGCACCCCGAGAAGTTTGAAAAGTACGGTCTCAGCCCATCGAAGGGTGTTCTCTTCTACGGTCCTCCAGGTTGT
GGTAAGACGCTTTTGGCGAAGGCTGTGGCCAACGAATGCCAGGCGAACTTCATTTCCGTGAAGGGTCCAGAACTCTTGACCATGTGGTTCGGTGAGTCGG
AAGCGAACGTGCGTGAAGTGTTCGACAAGGCCCGTGCCGCCGCTCCGTGTGTGCTGTTCTTTGATGAATTGGACTCGATCGCGCAACAGAGAGGTAGCAG
CTCGGGCGATGCCGGTGGTGCTGGTGATCGTGTGATGAACCAGTTGCTGACGGAAATGGACGGCATGGGCGTGAAGAAGAACGTGTTTATCATTGGTGCG
ACGAACCGACCGGACATTATCGATCCAGCGCTCATGCGTCCTGGCCGTTTGGACCAGTTGATCTTCATCCCAATGCCGGACTACGAGTCGCGTTTGAGCA
TTTTGCGCTCGGTGCTCCGCAAGAGTCCAGTGTCGAAGGAAGTGGACCTCAACTTCTTGGCCCAACAGACGGACAAATTCACGGGTGCCGATCTTACCGA
AATCTGTCAGCGTGCTGCCAAGTTGGCAATTCGTGAGAGTATCGATAGAGACATGGAGCGTGACCGTCTTCGCGCAGAAGCTGGCGATGAGATGGAAGAC
ATTGAAGAAGACGATCCAGTGCCAGAGATCACGCCTCGCCACTTTGAAGAGGCTGTACGCAATGCTCGTCGCTCCGTGAGCGACCGCGACCTTGCGCAGT
ACTCGACGTTTGCGCAGACTCTGCAGCAGGCGCGATCGCACGTGACGGCTGCCGGCACCTCACTCGCGAACTTCTCGTTCCCGAACCGCAACACGACTGT
TGGAATTGGCGGCGCTGCCGCCGCTGCGGATGAAGACGAGGAAGACCTGTACAGTTAGACGTGCAGAAATTGCAAAAACTTGTTGAGCGGTGGGTGAGCA
GCAACGTCGTTCTTTTTATCTTTTCTTGCATCCATCTTTTTTTTTAAAGAAAAAGCATATTGAGCAGTAAGGAAACATGTTCGATTTGTTTTGAAGAATT
TGTCACTGGGCTTAATGAATTGGTGTATAGAGAACGTGAAACACAATGGCGACTGCTCACCACGCCAGCGTTGCAACCACAGAGGCGAGAACCGATGCGA
TGATGATGGTTTGAGACTGGAAAGAAGCGCCGCGATGAACAGATCTGCTGTGACTCTTGGTGCCTTTGGCAACTGTCTCGCCAGCTGTCGATCTGTTATC
GTCAAAGTTGCCATCCCCAGCGTCGTAGTCCTTTTGCGCCTTCTTGGGCTTTTGTGTTTTCTTTGTCTTCGTCTCCTGCTGACGGATTCTTCCCATGAGC
TCGCGATGATGACCCGGCGTAACTTGCAGATCCTGCGTGGCTGCCTGCATGGACGGATTTCCCATTTGAGGAGAAGTCGATGGTTTTGCTGTGATATCGG
GTTGCGAATGCGTTGCGGGGCCACTTGAGCCGCCAACGGGTGCTGAACTATGCAATGTATTCACTGCGGCTCCGTGGTTCCTTGTTCCGCTTGGAGCAGA
CGCACCGGAAGGCAGAGCTCCGTGAGTGGACACTACAACTTGGGAGCTTGCAGCTGGAACGACGACGCTGATCGGGGTGGGCGCTGGAGCTGAGGGCACT
GCGTTTGCAGCTGAAATCGCGAGCAGATAGAACACTGCAAGGACGCACTTGTTCATGTGATTGCCTTGGGTCGTTCACTTTGTTGCTATAGCGAGCTTAT
TTCGCAATGAGGCTGCTGCAGACGCTCGGATATGTCATGACGAGCATCCATTCGTAGTTGAGTACACAGCCAGCAACCATACAACTCCCGCTCAGAAACG
CTCCGATTGGCTTCTTGTGTGGTGCAGAGGCTTTTTAGCCACCTGTATATCTCACACGGGATAATGAATAATCAATTGTCTGTGTTCTTGTGAGGCTAAC
TTGAGAGATTTCATTGTCTCCACAATTAACCGGTCGGCGACTGAAGGAACTGCCACAAGTTCTTTCCTTTCAGCTGAGAACTGACGGTACACTGGACATT
GCGTGCCGATTGCCTTTGCGAAGAGCGACAACTTGACCTAAATCGACTAAGCTAAATTTACCATCCGACTCGCGCCATTGTATTTTTTTAATTTGATGAT
GTGCAATCGATATGCAATTTTACCGATGCCACCACGTATATGCGAAGCTTCACGGCAGATTGGCCTTGGAGGATCCACCTCAGATTTGTGGCCTTGAATC
TAAATGTCAGCAAGTTGCTGCTGTACCTGGAAGATCTGTTGAATACACATTAGAATCCCGCAAATTGATGAAAATATTCTTTTGGGTTGGTCTACCTTTT
CATCCCAAGCTTGCAATTCTGCTTGTAGCTTTGTTTCTTCCTCCATACACCTGCTCTTAAGGCTTTGCTCGTGCGCTCGCAATTTTCCTTCTAGGACTTG
GTTTTTCAGATCCAATTGCGTTTTCTTTTCTCGAAGCATTTTCTGGGCTCTGTGATCCATGCGTGATTAGTTTAGGCAAGAAAAAGATGGGTCGCAAAGC
ATTGAGACGTACTCTGTTCCATACTACAGCAGACATCAAACACAACAAGAACCTTTGTTAGCAAAAGAACGTCAAAAGGGAACTCGTGCAGATGCAGGAA
AGGCTAATAAATACCTCTTTTGCTCTATCAAGCTCCGCAATGAGATGATTTTGCTCGGCTAGCTTTGTTGCTACTTTCACCTTCTTCTTTTCGATAGCAT
GTAATGTATCAGCCAAAACAGTTATCTCGTCGTTCAGCAAATGAGGCTTTTTCTGGTATTCCCCAATCTGCTTTTTCAAAGTCGTGACTCTAATATCTTG
TTGTTTCTTCGCATCCTGTAACTCTCGAAATTGCTCTTGGATTCGATATAGCTCGGTTTGCGCCGATTCAACTTTCGCTTTAGCGTTGTCGAATTTTGAC
TTTCTCATTTGTTCGCTCAGCTCCACCAGTTTGCAACTAACCTACTCAAAAAGTTTTAATGAAAGTTGCTAGGCGAGTGTCTGTATCGTCAAATAAAAGT
ATGCATCTTACTTGATTTTTCTCTACTTCGAGCTTTTTAATCTCACCCTAAACAATACAAGTGGTTAGAATGGCGAGAATGGCGATGATTCATGATGCAA
TATGTATAATAACTCAGCATACTTCTTTGTCTCGCACGATACCAAGAAGAGCTTGGACTTCCTTGTGCTTGACAGTCACATCATTCTGCAGTTTTGCTGT
TTTGAATCGGTCTCCGCCTCTATCAAAGTTGGAAATCTTTTCTACTAACTCAGCAATGTTTTCCTGCAAACACAATGTCTGTTACTCAATGCTTGAGAAA
TGGCACGTAGGGTGCATCAAAGCAGCGTACCTCTGTGTTTTGAATCTCAGTGCATATCTCGACCAATCTGTCCAGCAAAATGGTTTAGTGGTAAAAACAT
TTATAACGACAAGTCAGCACATATATAGCGTACTTCAAATCGAGCATGTCTTGCTCTTGCTTAAGCGCCCCCACAATTGAGTACGTATCTTCATTAGTCA
TCTGGACCCTTTCAAGCTCTGTTTCAGAGAACACCTATCAGATCACAGAGCACACCAACAGGTTTAGAGTACAAAATATTACCTGATGTCACGAAGAAAA
TCCTTTTTCGAAGTGAGGCTCGTTCATTTTTCATCTGATTGCGGACTTTTTTTCGCTTGGCTTTGAGCTTGCTATTTGATCGCTCTGTAGAGACGTTCGT
CGTGTGCGCACAATATTTCGTTAGAGCAAAATGAAATCAGATTGGCGGCAAGCAGCAGAAAATACCAATGTCGGCTTTCAGATGAACGATATCTTGTTGC
AATCTCCGCCGGATCATTTCGGCTTCCTTTTCTTCTGCCTGAAGGGTGATACTTAACTCCTGAGTTTCGTCTCGCACTTTCTTCAAACTGCTTCCCAATA
CTGCATGCTGGTTCGTTAAATCATTCGTCTCTCGTTCCATTTCAGCACACTTGTCTTCGATACATCTTTTGTGTTCTCGGAGTTTTTGAATGTCACTTTT
CAAGTCCTCAAGCGATGCCAGGTTATTCACTTTCGCAATTGCTGTTGCGCAAGATTTCTGTTGTGAGACTGAAGCAAACAGATATTTGTTATAAAACACT
TTACGAGGGCTAACGTACCAAGGGCTGTTTGTGCATCGATTGATGCATCAGCTAGTGCCAGATTTTCTGAGCGTTTGATTGCTTCGGAATTCTGCTTTCT
CAAAGCGAGCATTCCAGCCCGTAAAAGCTGATATTCTCGATGACGCTCAGTGATTTGCGACGACCGCATTATTATTGCATCTGAAACGTCGTGCACAAAC
TGTTAATGCAAAAATGATACATTGCCTTGTGAACAAACATACCTTGACGATGTTTATGTTTTGCTTCAGCAACTACAGATCATAAACTGGCATAATTGAG
CAAACGAAGTGTGCATCATGCAACATAGACTATGCATCACACCCACTTACGGGTTTTCCTTCCCTCTAGAATCTCCAAGTTTTTCAGATCATGCCCAAGG
GCACTCTTTAGCTTGGCATTCCGAGATTGCTCTTTCCGAATCAACTCCTGTCCGTAGCATACATATCATTAATATGGATAATTTACATTTTCTACTTCCA
TCCATGAGCGAGCGTACCTTAAAGTGTTCTACGCGCTCATTCACTGTTCCCACGTTTTCTTCATTCTGTTTGATACTCTCCACCAGCTCCATCTCCGAAT
GCATCATTTCCACTAGAAAAGCATCAAACAACAAGCACACATATTCGTGTAGAATGAAACCATCATTCATCAGCTACTGCCTGCGTTTCTAGAATCAACT
AAATCCAAGCACCCAGCTCACCGATGTACTTGCGCAGATCATTGATCTCGTCGGCCATGCTGTCTTTCTCATTCGCGCGCCATGGCGCCATCTGCGGCTG
CTTCTCCATCTGCTTCGCTTGATATGCTCTCGCCTCCTCAAGCACGCACTCTTTCGCTTCAACTTCAACTGGGAAATCTGCAAATGGCAGAATGCGGAAT
CGACCGCCCGCAGACAATCACTCACCAAGTGCTCAAGTGCAACCTCTCTCTACAAGAACACTCCAATTTTGTGGCAAACGAAAGCGGCACTCGCACCAAA
TATGGCGACTACATAAGTGCATTCATTATTACTCCATGCACGTGTAGTTATATTTCTTGCGCGCTCACTCTTTCCTTCCCATTTCTCTACATGCTACGGT
GATTCGCGGTCAAATTCTGGAAAAATATCATGTCGTCGCGTGTTCGTGCAGGCAAACAGGTCAGGCCCATGATGGTGATAATTCGTTCGTGGCACTTGCT
GCGGCTTGTCAATCTCCGCTTTTTCTGCAACTTTACTTCCACACCTTGATGTTGCCGTCGCGACTGCTTGATACGAGCATCGGCCCGTTGAGATCAACGA
GCGTCAGGTCGAGAATGCAGTCTGTGTGTGCAGGCGACGGTGGGATCAAACCGCGACGTTCCATTGTGACGGCGCTCTCGACGCCCCCGCCTGTGGCAGC
GACACTACTCACGCTTCCTTGCGAGCCATAGTACGACGAGTCCTGGCAAATCGTGATCCCCGGAGGAGACAGCTTCTTCCACGCCAGCTCTGGCTTGGTA
ATAGGAGCAGGAGACTGCGCCGACGAAGGCGTCGCGACAATCGCATCGCTGCCATTCATCTGCTGCTGATGCGACGAGCTCATGCGCCACCAATCGTTTG
GAGCTGCCTGGTTGTCATAAAACGATTTTGCTTCACCACTGCCGCATACAGTGTACGACGACTTGCCGTTGCGGACGTCCCAGTATCGGATCTGCTTATC
CTCACCACCTGTGATCAACGCATCCGTCATGCCGCGGAAATGGAGCGATGGGCAAAGGATTGCACGGACGCTCGGTTCTTCGCTGTGCAGTGTAGTCGCG
ATATCGTCAAAGGCAGTTGCGATGCCATAAATACCCAGAAGACTTCCCAAGACGCTCCGACTGCGATGAGGGATCGGAATATGCAGTAATGTGGGACATC
TGCCTGCCTCTGCCTCGGATGCTTGCACGTGCAACGTCCGGAAGACTGCGCGACAAGCTCCAATGCTCAAATCAAAGACAGCAACTTCACCATCACCAGC
TGCGACGAACACCAACGGCACCGAGGTTTCGTCAAGCGGGAGCGTATTGGGGAGCCCAAGACACGATTTCAAGCGATGGATTGATCGGTGAGACGAGTGG
CGCCAAATGCGGATCATCACAAGGAACCGCAGATCCCACAAGCAAATAAATCCGCGGCTGGTACCCACAGCAAACCAACTGACATCTAACGAGTGCGTCA
TGCACGTGATGTATCCGAGTTCCGGGGAGACTTCCAGCTTCCAGGCTTCTCGGCGCATGCGCAAGTCCCACGCGTGAATTTCGCCATTTCGAGTGGCGTA
GATCAATAGCGACTCGGACACATTGTTGAAATAGTCGAGAACCATGACAGCACTGTTTTCGGTTCGAATATCCTTCAGTCCCGTTGCATGGAAATTGCCA
CCCACAGCATTCACCTTGTCGACTCGGAAGACGTGCACAGAGCCGTTACTCGATGCAGACGCCACGGAGTGACTGTTCTCAAGCACCACCATATCGGTCA
AAACGCCACCTTGGCCATCGTAGGTGCAGCGAGAGCCTTGGTTGATGCTGTGTTGCATGGAGCGAATCGACCAGAGCTTGACAGTTCCATCGTTCGATGA
AGAAGCCAAAAAGCTGAAATCCTGGGCGGCTCCTATCCGGTTGACAGCTCCAGTGTGCTCTGCAAGCTCAGCAACGAGCACATTCTTGCGCGGTCGCCAA
CTCCGATGCGAGTAGGATGCATAGATACCAGCACCACTCCCATTCGCTGTTGGCATTCCAGCATTTCCAGATCCAGTCGAGCTACCGAACGTCGCATTGC
TGTAGATCGTATTCACTGGAGACGACGCAGTTGATCCGCTATCCACACTAATCCCAACACCTCGGTCACTGCCCGGGGTGGCTATTACACTGGCTCCGAC
ACCGTTCAAAGAGCTCTGCAAGGACATGTACGGACTCAGCGGGTGGTTGTATATCGAGTAGTAGCTTCCATCAGGTTGTCGTAATGAACCAAGATCTGGC
GGAAGAGGAGGTACTCCCAGTGCTGTTAACCGAGCTAGCAACTTTCTTGGATTCCTCAACGCTGGATCCATAGCGGATTCCTTGAACGCAAAGTAATGGT
GGTACGTTGAGTGTGTTCTCTTCATCATACGCTGCCGTGACGGCGACACTGGTGATTGGTGTGAATCCAGCAATCCGCCCACACCGTCGCCACCGTACAT
GTCTCGCATGTTCATGTTGAGCATACTCACCATGACTCCTCCACCTGCTGAAGCAAAGTGATTCGACTCATTGTGGGCTTGAAGCGCGTGCATTCCTACA
GACGGCAGACCGGAATCGTCATAAGACCCGGATCCCGACAACGGCATAGCAGATCCCCCACTGGACCCCACCGAGTTTAACGGCAAACTTGGCGTCTCGA
GACCATACATCTTGAGAATGAGGTGCAATGGCAGGTTGTCCAGCAGATGAACCTGGCCTGAGGACGATCCACCGTTGCTCACCATGTGTCCATTTGCAGG
AACGATGCTTGTGTCCGTGCCAGAACGATTGTTCGCCGCAGCTTGCTGCTTTGTGACCAATGCTGTCGAACTGCTTGATGCGATTGAGACGGATGGAGTG
GGTGGGATTCCAGATGGAATGGACACGCCAATCAAGTTCGACGTCTTAATAGGTTGAGCAATGGAGAGTGCATACCGCATGTCTGGTACAGACAATACGC
GCAAGTGAGACCGTGAGATCTTCCTCGCGAACGGGTTCCCATTCCCACCAGGAGCTGCCAGCACAGACGACGATGCCCCTCGTTCTGCCTTTGCGTGGCC
TTGCATTCTGGCTGCTTGTTCCGAATGCGCAAGCTCCATTTTACTTCGCATATGCATCGACGCGATTGCGACATACTGCTGCATGAGCTTCAACGCCTGA
ATTTCATTTTTCTTGTGCTCGTACGAACTTGATGACTCTGTTGGTGGCGGTGTCCTCGGGGAGCCTGACGGTACGCGGTTCAGATTGTAACTATCAAGCG
AGTCAACACTGGACAACACGTCTCTCTTTTTATTCCCCCCTCCGCGAGTATCTGCTGTGTCTGTGTCATTCGCCATCAAGTTCAGATAATTCTCCATCTC
TGCAATTATTTCATTCGAACCCGCAGACGACGCGATCAATGCGGCATCAAACGTTTCACGAGACAAATGCGGACGGCAGCAGTCTCGGAGTCGGATAAGC
ATGTCTTGCTCATGCTCGTCGAGTAAGAACACCATGGTCTTCTTCATAAAAGGTCGCAGCAACGGGCTCAGAAACACGTTCGCATCTACGCTTCCCATCT
GGATCGCGATGTACGTCATCAGCTTGAGGACAGCGTCACGGATCCACCAACTTGGATGCAGCAAAAGCGCCGACGTCATCTTGGCTTTTTCCACCAATGC
ACTGGTATTTTTTTGAAACAACCCCAGCTGGCACAATCCACCCAGGCATTCCACTGCCTTCGTAATCACGATTTCTTGGACATCAAACAGCGCTTGCTCA
ATGCAAGGCAGAATATACAGCCCCACAGTCACGCGACCCACGAAAGAACAGAGGCCGACAATGTAATCGAAAAATGCGCCACGGAGTTCCCAGTCACGAT
CGTTCAAGAAGGTAATCAGTTGCGGTAGAACGACGTCCAGTGTGCGCTCACGACCGAAGAAAACACACAAGCGCGTGATATCAACCAGCAGCGCACGCTT
GACGAGAGACGACGACGCTTTCTGGTCCGGTGCAGCCAACTGGATGACATAACGCGAGATCATTTTGTGCAGTACGTTCAGCTCCTTGTCAAAGCTGTTC
GATGCCAAATAGACAGGTGAGACGCCACTCGAAATCTCATTGCCTCCTCGAGAAGACATTGACGCAACCGACGTCTGCGATGCAGTAGACGTCGCTAGAC
TCTTTTGCTTCATAGCGTGCGCAATCTCCAAAAAGCGTCGGCTAGTTGCAGCGAGCTGGGGCAAACATTCAGCAAAGGCAATCCGCACCATCTCATCTGG
GTCTGACGGGAACGAGTTCAACGCTGGCAAAATGTACTGAGGGAAAATTGATGCGTCTGAAAGCGGGAAAGTCTCGATCAACGACAGTAAAAGTGTCAAG
GTGCGCAGCGCAAGAGCTCGCACTGACGCACTTGGATCCTCGAAAAGCTCCATCAGGAACGGAATCAGTCGCTGAAGACGCACTTCATCGCTTGCATACT
GGCCGAGGGATTTAATAAGATATACTGCTGTGATCTTCGATTCAGGAATTTCACAGTGTCGAATGCTGGAACAAACCAAAGACAGGATGATGACAATTCC
ATTTCGGTCGGTTGACCACGGCTCGCCTGAGGCTTTTCTCGTGGAGGACGACTTGAGTCTATCTTTTCTCGCTTTGTCGGAAAAGTTGGACTTGTTAGAG
CGCTTCGTGTACTCCCCGTACTCGTCCTGCTCCTTCAGTTCGGCACCATTCTCTCCATCAGCCTTTTCATTCTGCGTCTCCGCGGTGTAGTCGAGAAGGA
GTGATTGCTTCTTTTTCTGCGTGAGCGCATTATACTGGTCGTGGAGTTTGTTGATCTTTTTCTTTTGGAAGGTGCCGCTCAGATTCGTCATATCCACTTC
TTCCGACTTCATGTGTTCGAGTTTCGCCATCGTCCCGTTGTCCTTTTCATTTCGTCGATTCTCTCCTTTGAACGAACTCTTGCGGTCCAACTCTTCAATC
ACGCGCTGCGCAACATGCGTCTGGCCATCAGCGGCCACGAGGTCCATCACCAGTTGCCGATCTGATCCATAGCCTTCACGCAACCGCAACTTAAAAAACT
CTTCGCCCTCAGGATCTTCGACACCGGTCACCTCTCTCACAAGGCGACCATAGTACTTGCAAACCAACCGGATGCGTGCGTCAGGAACCTTGCCGCCGCG
ACTAAGAACCAACACAAGAAAGCGGAATAGGAAGCTTTCGAAGTAGGTCGGGAACAGACCGTGGTTACTGGTGTATTTCGCCAAATAGTCGGCGGCGGAA
GCGCGCGCGTTGGGATCAAGTTGAAGCATATGAAGGAGCATCTCTTCCAATCGTGGATCCCCCACTTTCTTCAACGTGTTGCGCAAATGTTCCGTGTCAC
CCGTGCGATACCTCAGCAACGTCGGGAGCTCGAAAAGCGGCTTGCCACCAAGGAAAATCTCTGCGATCACACAGCCCGCCGAGAATATATCCATTGACTC
TTGCAAATGCCCCTCGCGTTTGTTCGCATTACGCATAAATGAAGGCATGCTGCCTGGGAAAGAGCTGTTGACTGATGTCGGTGTTTGCGCGTGCGAAGGC
GTCGGGATCCCCATCGACAAAAACTGCTTCTCCACCTCCTCAACGCTCACTTCGCTGTCTGCCATGCGCGAGAGCATCATCGCGTCGGCTCCTTTGGCGC
TTGAACTGGATGAAGTGCCCGCAGGTGTCGCCGAAGAGGTACCGTAGAAGCGCTCTGGAGCGACACTGCACCCACGACGCGTGGCATCAATGGCGCAGAA
GTAGTAGTTGTAATCTGCTGGGTCGTCTTCGGGGATGTACGTCGGCTTGAACGGCGCAAAGTCGGTCAGAAACACCCAATTCCAGCTCGTGACCATAATG
TTTTCCTGCTTGATGTCGCCGTGGCAGATCCCCTTCGAGTGGCTCTGTTCGAGAGCTCTCAAAATCTGGAACGCAATCCATTTCTTCTCGATCTGTGTCA
AGAAAGGCCGCGAGCAGATCCGGTCGTACAGATTCGAGCCGAAATACTGGCGCACCATGAACGCGACGTTGTACTTCAGCGAGAGCTTGTAGTCGGCATA
CGGGATCAGATTCGGCTGCTGGTCGATTGTAAACGCGAGCGAGATCCGCTTCAGCGAGTTGTGGGCGCTCCTCAAGTCCTCATTCGGGTCGAACTTTCGA
TAAATCTTGACGACCAAGTGGCCTTCGTCGCACTTGCAGTAGATCGTCTTAAGAAACTTTCCGTCGCCGATCAGACTCCCAAACATGATGTTCATCGACC
GCGGCGAGTAGTCCATCAGGTACGTGCGGTACTGCGACGCACTGTCGAGCTGACTCTGCGGCTGCGCGCGCGGCGCCGCATTCCCCATGCTGCTTTAGAA
TCTCTCGATGCGCGTTTCACTCTTTTCGTCGTCGCGTCTCGAGTTTGTCGCCGATTTGAGCGCGAACGATGGCGATCGCGAACGGAAGCCTCGCTCTTTC
TCTTTGTCTGCTCTCCCTATGCGCACGTGCCTCTGCTGCTGCAAGTGGGACCCGAACGGAGCTCGTCGCCTTCCGCTGAGTTAGTTTCGCTTGTTCCTTT
CCCTTCCGCGGTTGAAATCTGCTGCTGGGGAAAGAAGGGGGCTGGAGAGTGTACCACAAGTGTACCGAAGTAGCGGTACATGTACCAGGTACGCAAGTCT
CCACGTGACGAAAAAACACACTTCCGTGACGATTCGACAAAGTGCGAAATTGCAATTGATTAACACTAGGGAACATGGGAGGAAATATGTGCATGTTACT
GAACTTTGCTTTATCAATGTGCGTGCGCTCTTTTAGTTTATGCTTAGCGCTTGGAGAACTTACCCTTGCCGAAAGCGCCCTTCTTCGGCTTCCCACTTCC
GGCAGCGACAACTTCGATTGCGTCCTTCTTGTTCGGGGCCTTAGCCTTGTGGCTCTTCTTGCCCAAGGTCGCCTTCCGATTTGCTCGCGCTTCTTTCAGC
TTCGCGCGCTTCGATGGCAACGCCATGCCTCGACGCTTTAACTGTATCCGCTGGAAGAGACTCAGCTGTTTCTCTTTGAATTTGCTGTGATCGCGCTTGC
CACCGCCCTCAGCCGCATCCTCCTCGTCGTCGGAGAGATCGTACTCTTCATCGCTGATCTCATCCTCGCTGTCGCTCTGCAAGTCGCCGATCGACGTCGT
CACGGTCACGACGTCGCCAAACTTGTTCTGCGTGTGCTCATCGTCAAAGTGCATCACTTTCGTCACGGCCTTGGATTCCTCGTCATCGTCCGAGTCCTCC
TTTTTCTTATCTTCTTGCTCCTCTGGAGGCTCGAGTAGGTTCAGACTCGCTAATTTCTCCTTTTGCTCTTCACGTCGCTAAGAAACATCACCATCAAGAC
ATGGTTAGCAAGGAAGACAGAGCATGCAGATAAGTATGCTTGAATGAATGTTGTATGCCTGCTTTCTCGCTTCGAGCAGACGCTTCTGCTGCTTGAACGC
TTCCATGTCCAGACCAAAGCGTCGTCGCTCTTGCTTTCGCTTGTGGAACCCCGTCAAGTACTCTCTGCAGTCGGCGAAATACCACACAGACAAACGTTAA
TCCAACCACCCAATGCAATCAACATCAATGCTCCAATCGTTCAATAACAGCAACAGCGTACTTTCGCTTCTCCGGGTCGAACGTGACCACCAGCTTGGAT
TTCTTCTTTGGGTTGGGCTTGCGGGTGCCTCCGCTACCGATGCTGCCCTTCTTGACGCCGCCGCCATTGCCGCCTCCGCTGGGCTTCTTGCCGTGCTTCT
TGCCGCCGCGCTTCATGTTCTTCGGCGCCATCGCTGATTGCGCACAAGTTGCTTCCAGATGAGCTCCGCCACCACTTTTCGGTCCATCGCCGCAACCACC
ATCGTTTATCCGGATAACACAACCTGTATAGCCGAGTACAGTTAACAAATCACTGCAAAAATTGCGTACCCAATGCTTTCTCAACGTCTAGCCATATCAA
AATTTTGAAGATACATAAAGTAGACATATATTTTGTTATAATTACGAAAAAGGATACAGGATGGGATGCATCTCTGGGATGTGGCAGTAGCCTCATCATC
GTACCCACCGCGCTGAATAGACGAAAGAAGAGGGAGTAAAGCAGAAGAAGGACGGAAGGCGCACCCGCTAATCCCCCCGAGAGCATGGGCGAAGAACCAG
TCAAGCCGATCCCGTTCGTGCTCGTGGCCGACGATGGCAGCTTCAGCGTGAATCCCGAGGCGTGCGAGCGCATCGAGAAGATCAAGGGTAAGCTCGTCGT
GATCGCCGTCGCGGGGCTCTACCGAACGGGGAAATCCTTTCTGCTCAATCTGCTGGTGCGCCATGTGCACAACATCGACAACGCGGGCGTGGCGGCCGAC
GCCATGGACGCCATGGAAAACGCGGGCTTTGCCGTCGGCGGCACGGTCAACGCGTGCACGAAGGGCATCTGGATGTGGGGCGAACCGATTGTGATGAAAG
ACGGCACCAGCTACCTCTTCCTCGATACCGAAGGCTTGGGCTCTGTGGATCGAGAGCAGACCCACGACACGCGCATCTTCGCGCTCGCGCTGCTGCTCGC
GACCAACTTCATCTACAACAGTCGTGGTGTAATCGATGGGAACGCGATTGAAGATCTCTCGCTCGTCGTGAACCTCTCCAAGCACATCCAGACGTCGTCG
TCGCAGAAGGAGTCCGGCGGAGCCGATTTGTACGAGTTCTTCCCGTCGTTCATGTGGGTCGTGCGTGATTTCACGCTCCAGCTGCTCGATAACGGCAAGA
AAATCTCGTCCAAGCAGTACTTGGAGAATGCGTTGAAGCCTCAGGGTGGGTACAGCGATGACGCCGTGGCGAAGGACCAGATTCGTGTGCTACTCTCGGA
TTTCTTCCGCCAGCGTGATTGCGTCACGCTTGTCCGACCTGTCGACGACGAACAGAAGCTGCGCACGCTCCCAAAGGTGCCGTACGAAGAGCTGCGTGAC
GAGTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAG
TCATCTCAAGCGCCTGGAGTCGCGTCGTGCAGGCGCAGTGCGATGACGCATTGGCGGACTCGATTGAGCTCTACAAGAAAGAGATCACGTCGCGCATTCG
TGTGTACACATCGCCCGAGCAATACGAGAAAGACGCGGATTTTGAAGACGAGGAAAAGAACCGCAACACATTGTCTCCGATCGATTACGGCCAGGGTGAC
AATGTCATGTTTGACGAGTTTGGAAACTTGCGCAACGTTCAGATGAAGGCCGCGAATCCACAGACCGACGAAGAAGGCCAGGAAAGCGAAATGATCGAGG
TGATGGAGGAGGACGACGTCGAGGAGCAGGTCAAGATCGAGCGCACCCGACTACCGTGCGCGGAAGACACGCTCATGCACGTCCACAAGTTATGCAAGCG
CATCGCGAAGAAGCGACTGCGCGAAGTCGTCGATTCGGACATCAGCGACGATGCGAGTCAGTATCTGGACCAATTCCGTGTCGCGATCAACAGCATCTTC
GATACGTTCAAACAGCAGAACGCTGCTGCGTCCATGGCGTACTGTCGTCACGTGCTGGAGAAACTGAGTCGTCCAGGAAAGGAATACTTGGAGGATATCG
AGGGCAACAACCACAAGTCCGCGATGGAGCTGCACCGCGAGACGCAAGAGTACCTGCAAGGTGCGCTTGAGACTGTGTACGACGAGTACTTTTCGCGCGC
GATTGGGCCATCCGCGGATGCCGCGTACTGTGAGTTTGTCACGCAAACGGTCGTCGGACAGGTCATCCAGCGCACAGAGCACAGCAACGTCGCACACATG
ACCGAAGTGCGCGCTTTGGAAAAGGAAATGAACGACATGAGCGTCAAGGTAGCTATCGCCCAGGGTCAAGCGGGTGCGATGCAAGAGCTGTCACTGCAAC
AGCGGCAAAAGTGCGAGCTGACGGTAAAAGAAGCAGAACAGCGCTGCGCGAACGAAATCAGCGCGCTGCGTGCGACCCTGGAGTTTAAGACCAACGAGTT
GGAGCACGTGCTGAACCACAACGCGACCTTGAAGCGTCTCGCAGACACGGCGCAGCAGGGCCAGTATCGCGCCACGGAGTTTGCGACGTCTGCGTTCGCG
ACCGTGCTCGCTGGGTACCTGATCAAGCAGCAGGTCATGCCGGGTCAAGTGCCGTCGAAGGCGAAGTGGCAGCAGCGATACTTTGTACTGCAGGGCAACC
AGCTGTCGTTCTACGACACCAAGGACGACTACGAGCGCTGCCGGTCGGACAACCCGCCGATGGACGTCACAGGCGCCATCATCGAGGACAGCTACGTGAT
CCCCGAGGCGTTCAGCATCTCGTTCGCCGAGAACAAGTACTTCCCGCTGCACCTGCACGCCAAGTCGCTCGAGACCAAGAAGGAGTGGGTCGACAGTCTG
CGCCGCGCGAGCGTGAGCAGCCGCGTGTCGTCGTACGGGACGCTCTCCATGTCCAGCAGTCGGTATATGCAAATGTAAGTTTGTGGAGGAAGGCGGTAGG
AGAGTTTATGCTTGTGTGCCAAGTGTCCATTTTGGAAGCCTAGTTACCCTTTTTCGCCTTCATCATGTTTGACCCTGTCAAACAAACATGATGTCGTACT
TAAGTGAATAGAATAGGTAGCGCAGTTGCGTGGCTGGGTTTTCATACACCCCTTCTTTTCAACTTGAGCTTTGTATGTCATATCGGGCCGTCGTGGCCTC
CCCGTCCAAAACCACCCCTTCAGGCCAATAAGCACCCGCGGAAAAGCAGAGGAAGAGATTTGACCAAGAAGCAACAGCATGTTCAAGTCGCAGCTCCGCA
CGAAGGACGAGATCCTGGCGATCCGCGCCGCCGAGGAAGACTACGCCAAGCGCACGCTGCTCGCGCAGGAGACCGTCAAGCTCGTGCGCGAGGAGCTCGC
CAACTGCTACATGGAGCACGGCGTGAACCACAAGATTGCCTGCAAAGGACTCCGTGAAGAGTACGCAAAGCTCGTGCGCGACCCAACCCACGGCGCTGGT
TCCCCAGTAAGTAACCGCTCGTTTGTGCGTAGTTGTCGCTGCGTGATACGCTTGATGTGGACATGTGCTGACTGTGCTTGTGTGTCTGCTGTTCATTGTT
TGTAGAACCGACCAGAAATCTAAGGCAATTGTATACAGGTGGTGAGAGAATGCGGACGTCCTCAACGAAAACAATGAAAAACACGACATTAAAGAAACCA
TTCATGTAACAACGATCTGTGTTGTGGCAGTGGAGACGACGAAGAAAAACGGAGAATATAGCACTCTTCAACATTGTAAATCTATCGACACTGACGCGCA
CGCACCTCCCGTATTCGTTAGCTGGTGGTATCACAACGCATCAGTGAAGTACTTGGAACGTCGACGCTTTGCTCTCGCTTCCTCAATTCGTCGTAGCGTG
TGCTGGAGCCCGAAATCATCGCCACCGTCTTCATCGTCTGCAGCTTTTCCCCGTTGAGAGTCAGGTTGATTGCAGAAGACAGAGTTTTTCTGCTTTGGAA
TGCAGACAGAATCTTTTGGTGGCGAAAAATATTCCTTGCGCTTGCGGTGAGATGCCAAGTATGCGCTGTTGCTTTCTCGTGGTCGCTCGACGCTTGCGTA
ACGACTTTTTCTTGCCTTCTTGTGCATTTGCTCTTTTTTCAAAAGCGTGCTGATTTCACTGGTGAAATTACTGACATGACTTTCCATTTCATCAAATCTG
GATTGAAGAGATTTCACTGCTGAGCTGGCTGCATTCGCTTCCTTCGAAATACTCTCGTGGCATTTGTCGAAGCGAGACTTCATCTCGTCATTCTACATGT
GTTGTTAAAAGAGAAAATTAGACTATCAGTCAGCCCAGCACACTCTGTAATTTGGCAGACAAAATAAACCTGATTATGGAGAAGTTTGAGGGACTCGTTG
ACAGCGTTCACATCAACCGCAATCGTCTTGAGAGCATCTAGCTGCATTTTATGATCAGCTGACTGAATACTGATCGATGTGGATAAATTTGTCAGCTCGT
TTTGAATGGGAGCTGAAAACTTATCGAGCAAGTCGTTCTCAGGTCTCTCTTTCTCGTCGGAAGGTAGCTTACTGGGAAGAACTCTTCGGCGATGGGACAC
CGACGGTGCGCGAGGACGGTTCTGCTGTTTTGAAAAGTAAAGTAAGCATGATGACATAATTCCAGGAATGACAGCCAAAGGCAAATCCACAAACAGCTTC
TTCTTGGCTCGCAAACAACATATTCTGCGACTGTGAGAACGACGTCTGAGATTGAGATGTGAATCCAGCGAGATCTTCATATGCTGCTACGAGTCGACGT
GAGAGAATTAGCAATCATAGACATAGGTTTACCTGCAATGCACAGACACCTACTTTCTTGAGATTGTGAATATGTCGATCCATTCCGTCGATTCCTGTTC
TCTGAGTACAATTCATTTTGGCTGAATGAAATTGGCACTACTTTGTGTTTCTCTGACTGATGTTGCTGGCTACTTCGCAAAGGCTGGGAGCTAATTCTTG
GACGGAAAGGTCCATAATTATGAGTCGACGGAGTTGGGGTTACTTGCGAACGCGGTATTTTCCGCACTTGCTCATAACTTGGTGTTGATTGAATATTCAC
TTGTGGTGAGTTCTGCACAGTACTTGACGCTGACCCACTAGATCACGTTAATGCACAAGTAAATGGTAAGCGTGATTTCCCTGTCCCCCACAACACACAC
TCCAAGATCCAATGAACCCACTTACGTTTTCCTCCGCTGAAGCAGCTGCGATAGTGAAATCACCTCTCTGCGCACTGACATTCTTTTGTGCGTTTGCTTA
GCGTCTTCAGCAGCCTTCTTAGTCTCTCTTCACTCTTTGCTGCAGCGTGGAGAAATGCGGAATGATGCGCACGTAGAATGCGGAATCGAGAACTTCAACT
TCCACGTTGGTGTCGATTCCGCACTCACTTGGTCCAATCCAGCCAATCAGAGCTCAAAGTTCCTCTAGAAGAGCATAATGTGCTCTTGTACGGGAAGATT
CCCAGTCTCATCAGTCTGAATGATACCATCACTGTGCGAAGCCGACAAGAGTCGCAAAGGTGTAATGTAGAGGCAAGATGTATTAATGGACACTTTAAGT
TTGGCAAGGAAACGGCAGCAAAAGCGATCTCGATTCGTTCTCAACGGTGACTTGTATTGTCTCTTCTTTATAACGAATTGTGTATTGTAGGCGTATCGGT
TTGCAGTTAAAAAGAATAGTTTTGTTGCTCTTCATCGTAAATCTCAGTGGATTGACAGATATAAAAGGTTTCTCCTCATCTACGCCCAAGGTATATGGAT
ATGCATAACTTCATACAGATATTCAAAATATGTAAATGCGAGGCTTGCATCAGTTTGCAGTTAAAAAGAATAGTTTTGTTGCTCTTCACCGTGAATCTCA
GTGGATTGACAGATATAAAAGGTTCTCCTCCCTTGCGAGTCTCGCATTCGCATTACACACACTCGTTCACAAATACACATACACGCAGATTTCAATTCTT
GCGAATGTCAGATATTTTTTGCTTCTCGATTTTCACCAATGCGAACTACTATGTAGCCGCTCAGAAGACCGTCGTGAAAACATCGAGATAAAAGGATCAT
CATTTTACGCATCTCCAAAATAAATACATAGACACACAATCAGGCACAGGCACAGCACACACGCGCGCCCGAATCACGCCCTCGCAGACTTGCTTGTTCA
TATTGCATCGTCGCCGACCGTATCGACGCACTCGCTGCTTTCTTTGACTGTGCCAAACTGTAATTGCTCTGTTGTGGGTGAAGGAACACAGCCACAGAGC
TGTCCATCCGTTTATCCAAATCTGTAAAAACCGATGCCATCACGTAATTACGTCTACTCTATTTCTACCAACCAAGTGAACGTATAGCAACCCCAAACAC
GTAAGAAGTTGTCTAGGTTGACCTAGAAAACAAAACCAGCAACCTACAAAATTGCAACTGACCATCATTCCTGTCCTCAGGGTGGAACGTTCCAAATTTC
CTTGTGTCTGAGCGCGGGAAAAGATGCGAATAGGACCCGCAAAGCAGCAGCAGCAGCGAGTCGATGGCGGCGTTCGGGGCCGCTTATGACGCCGCAGACG
ACGCGCGGCGATGGCGCAACGAGAACGACGCGATGAACGCGAACAGCAGAGATGACGAACGCGGCGTGTCCTCATTGGAGGAGAAGCGCATCGGCATGCC
TGGTACGTAGGTAGTTCTTCACGCTCTTAAAAGATCTTCTCTCGTTACCATTTGCTGCTGGTGGTGGCGTGGATATGAATGGATATGAGTACTTACATTG
CTGGTGTCTATAATTGCAGTCTCTTTTGAAGAGTTGTTGACGCGCGAGTTGGCCAAAGCGCAGCAGACAGGTGCGTCCGTGCAAGACGTGTCTCCTGGCA
CGAGTGGCGGGAACGGGAACGCAGCATCGCGGAAGCCGAGTGTTCAGAAGAAACCGTTCTTGAAGAAAGGCGAGCGCGGATGGTGGATGCAGCGACCTGA
CGTGAAGGCGAAGCTTCCGAAGCACACGCTGGTGTCGAAAGAGTTTAATGATGGCGAGCTGAGTAGTTCGAAAGCGACGACGACGGCAACAGGCATCGCC
AGCATGCGCAGCTCGACGCAACCAGCAGCTAAGAAGAACTCCAATCAGTCGCTTGAACGCCAGCAAAGTCGAAACGAGACGGATATATCGGAAGCAAAGA
GACTTGCTCAACAACGAAAGCAGTATGTTCAGTTGCCACCAAGTCCGCCGCCGCCACCATCGCGGCAATTTCAACACGATTACACAAAAGCTCCGTTGTC
GCCACCTCCTCCTCCGCCAGCTCGATCTCCTCAGAATGATTATATGAGAAGCCAAATAGTGCAACCTCGACAGACTCCGCGACTCAGTGACTCGATGAGA
ACCACGGGCAGCATCGACACACTTGGAATGAGCGGCATCCGTCAATCCTTCGAAGCGCAACTTTCACGCGAGGCAGACGAACTTGCCGATTTTGAAGCCA
TCGAACGAGAGTTGGCTGCAGAGAAAAATGCGTACCTCATGGAGAAGAAGCAGTTCCAACAGGAGCAGGTCCAGTGTGAGTCACATGAACGCAAGGCGGC
ACCTTCGTGGCATTACTCTTCTTCTGGAAGCAACGAGCGCGCATCTCAGCAACATGCAGATTATCAAGGACGTGACTCTGCCTTTGGGATCGGCAATTTG
GATTTGGATGCCCATTCATCACTGTTGTTTGCTGAGGAGCCGTCTTTCTTGAATGATGACGACAAATTTGAGTCCAGTAGTCGCTTTTCAGCCGATCAGC
GACGTATTAGTGACCATTTTGCAACGCAGTCGTACGCTGCATCTGAGCTGAGCGCTATCAGTTTGAATGATTCAGAGCCCTGGGGCGACCAAGCATCGTT
CCGGCAGGATGGTCGTGGAGTTCGTGGGAGTATGTCGCCGTTGCCGAGCCCTGGTAGCGAGGCCAGCCTTCTTGCTGAAGCCCGACATGGGTATTCTCGT
GGATATGGATCGTTTGAAAATGACCTGGTTGCAAAAAGCGAGGAGAAAGAATATGATAATCATGCGAGTGATTTATACGATTATGAAGACGAAACTATGG
AGAGTCGATTCAGCGAATCCAAGACATCTCGGCATGCGGCGTACAATAGTGAACCTCCAGTGTCGGCACTGATGCAGCAGATTTTTGGCAAGAACCAAGA
CGCGGCTGCCGCTGATCAAGAAGACGATATGTATGATACGTCACATGACTCTGATTACTACAGGCACGAAATGGATGCAAACGCAGCGAAACTGCAAGAG
GAAGCCCAACACAACAGTCAAGTAACTGCAGACCGATCGAAGACACAAATCAAGCAAGCTGGTGAGCCCAAGAGCAAGATTCCGACGCGATCAACGCGAG
GGGGTAGCACGAAAGGGAAGACACAGAGTATACCAAGAAACCAAGCGAAGCGGGGGGCTTCTAACTCGAGACAACTAAACTCTCAAGACACAAGCTCGAA
GCCTAGAACTGGGCCAGTGCTACCTGTCGTCATTGAAGAGAAACTGTTTGAGCTAGAAGAAGAGGTCAAGTTTTACAAAGCTGAGACGCTTCAGATGCAG
AAAAAGAAAGACTTTTACGAGCAAGAAGTGAAAAAGCTTGCGAAAGAACGTGAAGAGTTTGCAAAGTTTCAGCACGAACAAAACGCGCTGATACAGAAAG
AATGGGAGAAGGAGCGTCTGAAGATGAAGCGAGAGGAGAAACTCATGGAGCGTCAACTGAAGCTGAAAATGAGCGCAGCGACGTCGCACCAAGACCGAAG
AGAGCGAGGTGAGATTGAAGCGCTGAAGGCACAGATTGTGAAAATGCAACTGGACGAGAAGGCACGAGCGAACAAGTGGAAAGCCATGAATGAGAACCTG
AGGCTGCGTATTGGGGTACGTCCTCACTCCAATTGCACAATGTACATTCTCTGTGACAAACTGACATGTTCTGAATGGATATTTGTAGGAGCTGGAAGAT
AAAAATCGAGAGCTTACCGAGGAAATCAAATTTCTAGAGAAAGATCGCCTTGAGCAGTGGGGAAAGTACGAGGAATTGCTGAAAGACAGGCAACGTCTGG
CTGAGCCACCAGTGAGAGCGCAGCAAAAGAATACGCATTTCAATCTCAGCGACGACCGGGAGTTGCGAACAGTCAATGATTTGTTTGCAATCAAGGACAC
TGCAGAGGAATTGCTTAAAGGATGGCAGCATCGGTCGAATAACTTTGGAGCAAGCTCTGAGCACGAAACCAAGGAAAGCCGCGCGGAAAGGAAAAGCGGT
GACTTGCAATCAAGTTATGGGGATTTCTACCGAGAGAGTACCGACTTTAACAGAGACGATTTTCATAGCGCGAAGGGTACACACAAAGATACAAACTCGG
ATGTGTTTTCATGGGAATCCGCTGATTCCCCGCAGCGCTCTTCCAAGCATGCAGACAAAGGGGATGGATTATCTCACGACTCAACTTCGTTGCATCTGCC
GACGGGCAACTTGATCGACGCCAAGCGAATTGAGCGAGAGATTGTGCAGCCTGGAGGGAAACGAGAGTTGCTGTTCAGCGATGGAAGCAAGAAGATCTTC
TTCGCTGATGGAAACGAGAAGGAAATCGACGCGGATGGCCATACGACAATCAAATTTACCAATGGGGATCGCAAAGAGGTACGCGGTAGCAATGCTTTTA
CTTGTGATACTGAGTTCGCACTGATGTTTTTGTTTGTTGTTGTTGCAGCTGTTTCCTGACACAGGCATCAGTATCTACTATTATTATGAAGCCCAGACCA
AGCTGACGAGTTACCCTGACAGTACCAAAGTTTACGAGTTTCCGAACCAGCAAATCGAGAAAAGCTACCCAGACGGGACAACTGAGATCTCATTTGCCGA
CGGTATCAAGAAAACGATTCGGCCGAACGGCGATGAATTTTCTGTGTTTCCCGATGGAACGACCATGTTGGAGCAGAGAGATGGTCTTCGAGAAGTGACG
CTGCTGAACCAGAAGAAGATTCGGTATCTCTCCGATGGGAAAATGGTGTGGGTGGCTGCAAATGGCAAAGAGACCCAAGTGCGGTCCGATGCCGAGCTCA
AGAAACTCATGGAGAGTCTGTAACAAAGATGCAAGAGTCCACCACAAAGCCGTGAAGAAAATCACCTTGTGGGGGTCGAGACGAGCTTCTGTACGATATT
TTTTTTGCTGTAAAGAGTGTCAAAGCTTCTCCGAAACGAAGCCGCCCAGGCACGCCTGAGCGTTTGGCTTGGCTGCAACTTTTCTAAAGCTTCGCTGCGA
ACTATACGAAGTCTTGGATGCATGTGATGAATTATTTCTGAGAATTTCCGCTTTGAAAAGAAGCTGAACTCCCAGATAGCATGGAAACTTTTCTTTCTGT
CTGGGTAATCCAGTGGATCTGGCCATGATGATGAGCCAAGCGTCACTCTCTATGCACCAATCGAGTTTACCGGGTTACGATACAGCGAACGGTACAATCT
GCTTCGCTAAAGTACGAGTATCACCATAAAACCTACACTTTCCTGAAGCAATAATCTCTCGATAACGGTTACCATACATCATCTCTAATCTATTTGTGGT
ACCAATTATTATACAGTTAAGTGAAACTATATTGCATTCATTATTCATATCTGATACTAAAAAGCAAAATACTACCCTCCTTCAGTGAATTATGTATTAG
CAGTAGCTGAGTCCCACTGTAACATTCTCAATACATATCCAGAGATGCCCAGTGAAACGCGAGGAGCTACACTCGCTCACCCCCGCTCGGCATTCGCGCT
ACTGCTCCGCAGACACACTCAGATCAGCAGCACAAGCGCAGCAGCATGGACGCGTATCTGCAGGCGCGGTGGGACGCCACCACGCTGCGCACGGTCGAAT
GCCGCTTCTACCAGAGCAAGGCCGCGAGCGCGCTCAAGCGCATGCAGCTCACCGCAAGCGGCATCGAGCTCTTCCATGCGGTGGTGACGTCGGCGGATGC
GCGCGGCAAGAGCGCCGATGTGATCCCCTGGCCCGATATCCTTGGCGCTGCAGTGCTCACGCCGGAAAAGCAGGCGGCGCATGTGCCAGGATACAGGGGG
AAAGCGATGCCCAAGACGGACTTTGTCGTGTTTGGCTGCATCCCCAAGGCCAATGCGATCAAGAACCCGCTGATCGCGAGCGGACTGCAAGTACTCTCGT
GCTTCACTGGGACTGGAGCAAACGATGATGTACCCGACGTGAACGACAAGAAGCGCAAACGAAGCTCGGCGCCCGTGGGCGGAAAGTGCGATCGCATCAT
GGTGCAGTGGGTGTTCCGCTACAACGTGGAGGAGGATGCGGATACGTTTGTCCCGCATGTCGTGCACATGATCCAGCGTCTCGCGGATCCACGCACAGCT
CAATGCACAGAACCCGAACAAGAAGACGAACGCACTCGTCGCGTAAGTCGTTGATTGAATTTGGCACATGCGAGTCGTCGTTGTGAATATGGATAGCACA
TGTGAGTGGATTAGGTCGCTAATGTGATGATTGGAATCTTTGTGTGGCAAATCGCAGAAATATCTCGTGCTCGTGAATCCTGTTGGTGGGACTGGCAATG
CTAGGCAAGCATATTACTCGATCGCTACACCGATCTTGGAGCAAAGCGATATCGACTGCGAGGTGATCGTGACGAAATACCAGCACCACGCGACGGAGAT
CGCCGCGGAGATGCCGTTGAACACTTACGATTGCGTTGTCGCAGTTGGCGGCGACGGATTGCTCTCCGAAGGTGCGTTCTTCCTGTTTTGCTTGAATTCC
TTGATTTTAGTAGCAGGTCCTTTTGTAAGCTGAGCCGGTATGTCCCCATCTGTGCAGTATTGCAAGGGATGATGAAGCGCCTCGACTGGAACGAAGCGAT
CAAGCAACCTCTTGGCGTATGTGCTACTAAATTCCTTCCATTAAATGGCCTCGATGCGAAACACGAAAACCTCATTTGCGAACGATCACTGACTCGTTCT
TGATTCCAACCATCTACAGATTCTTCCAGGCGGATCGGGCAACGGAATCAGTGCGACGCTACTCTATCGCAGTGGCGAGAGCTTCGACCTCGTGAATGCC
GCGTACGCGCTCGCCAAGGGCACTTCACAGGAGTTGGACATAGCGAGCGTCGTGAATGGCAAGGACGCCGTCATGTATTCGTTCCTGTCTCTCGAATGGG
CGTTCATGGCCGACGTTGACATCGACTCGGAGCGGTATCGTATGTTTGGTGGCATGCGGTTCACGATGTCGGCGATCGCGCGCTTGCTGTCGAAACACAA
AAACTACACGGGCAAAGTGCGATATCTCTCGTCAGAGCACGATGACGAGCCGCCACCCAAGTACCATGACCGAGCAACTTTAACCGATGAAATTGACGCT
GCACGACCGAGTCTGGATGTGCTCAATAAATCCAAAGCAAATCGTGAAGTGGTGGATCAAGTTAATGGCGACGAAGAGACTCAACTCGAGACACAAGACA
CGAAGAAGAGACTAGCGTCGCAGGGTGAATGGAAGGAGCTCAGCGGTCCGTTCCACATGTTTTGGGGTGTGAACGTATCTCACACAGGCGCCCAGGGCCA
TTTGGCCCCAAATGCGCGCATCGACGATGGGTATTACTACCTCCTAGTCGTCGAAGGCGCGTATTCGCGGCTCAACATGACGCGCATGCTCTTTGGCCTC
GAGGACGGCACGCATGTCGGCAAGAAGCAAGTGCAATTGATCAGAACGCGCGCATTCACGCTGCATGTCGACAACCCCGCGGACCGACTCTGTGTGGATG
GCGAGCTCTTTGACGGGCCAGAGGTCAAGGTATGTTCGCTTACTGGGTGGCTACCGTGCTGTACAGGGAAGCAATACACTTACGTAGCTTTGGTTTCCCA
TGCTCTTCTCTCTACAGATTGAAGTGCACCGAGCGCTGGGCCGAGTGCTGTGTTTACCACCGCAGCAGAGGATATGAGCGGCTTTGCTCTCTCTCATGCA
GTTATAAAGTATCCGGCGCATGGATGCAGTGAGGTGGAGTGAGCAGATCTGCTACATGCGCAGACCAAGAGACCAGAAGCGTGCTGTCCACCCATTTTCC
ACTATTGATTTTTAGATTGTAGTGCAATTTATTTTTGTTTAATTTTAGCCAGCTCTGTGGAAAGAGCGGGACTTTGCAAAGCCTTTACTGTCACGAGCAC
AATTATATTTCTTGCAAGTTATGCAATTTGATTGGCTAACTTACATCAAAACAAATGCTCAAAAAAAGTTTTGGTCCGGTTTTGGTTCAAACATATATCC
AAGAAGTTCAATTTCTTGCACGACCAATCGAGCGGACCCTGTCGGCAATGTGCTGTGTGTCCATAGTGGTATGCTCGAATTTATAAAGTGTGCTTGGCAC
GTGTGGGGGTATTTGAGACCACTTTGACGACCACTTGAAAGACAAGACGATCCACACGACTCGGAACTCATGCAGATCTTTTCTAAGCAATCTCAGTATA
ATTGTAAGACGTTTTTTGCGGATTTCTTCCGTTACAAGTCAGTTAGCCTTGTTTTAACATGCTCTCCATCAATTATTGGAAGAGTCATGACCACCGAAGA
GTCACACCTGATAAATCAGACAATGTCAATAGTATTGACTAATCCATGGACTGTCTGTCGCTGCTCGCGAGTTGTTTACTTTTGTACTGGATCTTTATTA
GCCCACAATATGCATTTCGGGCCCACATGCGTGTTGTACTCGTAACACATTCGGTATTATTTTCTAAATGCTGCAATTAATTGTTGTACGCTCCTAGCTA
TGGCACAATCATATTGGGATTACCCTCGTTGTCGCGTTTCTTCTTCAAGCTGACGACAGCGCGCACCTCTTCCTAGGAGGCGTCATCTTCCACATTTCCT
CCCAACTTGAAGACGTCGTAATCCCCGTCAAATATGATAAAAGATACCGCTTTTTTCCCAATAGATTTTCACACATACCCAGCATACTATTTTCCTACAT
CCTGTTTAAATGAATATGTGACATGAACAAGCAAGCACTGCCAACTGCTCTTGTTGGGATCTCGTGCTTGCACCCATCACGCACGCGCCTTTTCAGCGGC
ATTTACCAACATGGAAGCCGCAAGCAGTCGCCCATTCGTGCTTCCCTCCTTCTCCTTCTCGAGAGAAAGCGAAAGATTGCTATTCAACACACGACCGCAA
CATGCAGCAGCCGTCGACCGTGACGGTG