Description :
From Genome Similarity Track
Location :
Scaffold_1390:4233- 7203
Sequence
2970 bases(100 bases per row)
CTGGCGTTGCCATGTATCGCAGTCTACCAATGAAGCTTTACGAAGATTCAACTCTTTCATTCCAGTATCGAATTTCTTCAGGTAAGAGGAATTTACATGG
ATTTATGGGCACTTGCGGAGGCTTATAATGCTACTTGTCACCCCTCTCAATAGCGTTTTCAAGTTTAAGGGCCGAAGCCCTGATCAATGCAACGCAACGG
GAGCTGCTATGGACAAGCAGCACTTCGGTAATTCAGCCGCTAGTGTGGAGTCGTGTGGAGTCTCTCGTTTCCATCATGTACCCGTCGATCGTTGAGTTTT
ATTTCTATAGCGAACCTGCGCAGAATGATGCCATGTCACTCAAAAGTATCGCAGTCGTTGATCCAACCCAGCAAACCCAAATCGGAGAGCTATACGTACT
TGAGGCGACGGGCGGCATGATTAAACTGCAGGTGGATACCGTCGATGTACTCTCGGATCCTATGTTTTTCCGAGTTCGCATGAAACAGATCAACTCCAGC
CAGCCTAGTTTCCTGTCTTACGCAGGTATGGACTTTGGTCAGCAAATCGCTACTGTCGTTGCTAGATTATGTGCTTACATGAACCGACTCTCTTGTTGAA
CAGGATTGGGTGTTGAGTTTCAAGGATGTTATCCTACTACAAGGATGTACAAGCTCCCAGCGAAAAACTCATCAACAGACTCTTCTCTTCTCAATCCAAT
GGATCCTGCTGTCTGTGGAGTGCGTTGTGCAAACGAAGAGGCTCAAATTAGTTTTACCTCGACGTCGATTGTTCGGAGTGCACAGGAGTTTGCAATTCCA
GCCAATGGTTTCACAGTGGAGTTTTTCCTCAAGAAGGATGGTGAAAATGCACCACTGGCACCTCAACTGATCATGCTGTACGGAAACACTGAGTCGACTA
GTATTCGCATCACGTTGGACCGGTTGTTTGTCGTTTGGAAATGCTCAAGCTTTCTTGTGGTTCCGTTCGAGATACCGCTTAGCGAGTGGACTCACTTTGC
ACTCTCTATGGACGACGCAAGTGGCCAAGTCCGAGTCTTTCTAAATGGTCTCATAATACTCACCGGCAAGTTGAGTAGCGTCGACTGTGAAATTCCAGCA
TCGTCATTCGTGCAATTTGGAAGAGGTATATCGATGATATACATCTCTGGTCCATGCTGGCATTTCTAAGTCAAATTATGATCGTTGTGTTTTGATTTGC
CCAGACTCGATGGGAATCTTGCCTGCAAACTCGACGTCCCATTTTGGAGGTGGCATGGACGAGGTATGGACTTTTTTGCTGCACTTGTTCTGAGGTGTTA
AAGCTAATCTATCAGAATGTTTACTGCATTGTGCAAACAGATTCGAATTTGGAATGGCGTTCGCGAGCCAGAGGACATTTTTACCTGGCACAACTCTAAT
TTGCTGGACCCCAAGATGGTATTAATGCTTCGGATTAATGCGTATGACAAGGACGCAGCACAGGTTCCTTCTGGCAAAGATGACAGCGAGAGTGGGAATC
ATTTTACAGTCGAGAAGATAACACTCTCCAAGAGTCACCGTGTTCGTTCCTTTGGTGTAGCTGGAGATGGAGCTTGCTACTGCGGTCAGTTTGAGTTATC
ATCCACGTTAGAATTGGATACACGTGTTTGCAACCAACAATGCGATGACGGAAATTCGGGAAGCTGTGGATCAACCGAGACAACCCAAGTGGTGAGCGTA
TATACCCGTGGAAAGCTCCATGTTGGTGGCTTGACGCCGTCGACTGCTTACGAGTTCGCTGTGTCCTTTGTGACTATGGATGGCAATGAGTACGACATCA
GTCAAGCCTTAATTGCACGCACGACAAATGCGACGACTCCTGGACGCGTCGAACATCTCAGTATTGTTGAAAGCTCTGGAAAGTACGTTGAGCTTCAGTG
GAGTGCGGTCGAAGACACTGGCGGCGCCGAAATCATCAAATACCAGCTGTTTGTGAATGGCTACCTTGAATTGGAGACCCCAACAGGTGATACACTCTCC
GCAGTACTGGAAAACATCGAGTTTATCTCGAATTTTACCATCACAATATGTGCTGTCAACTACTTGGGAGCGGGGCCACAAAGTTCACTGCTAACGTTTA
CTCCCATCGACGCGGAAGTTCCCGATGCACCGGAGGCCTTTACGCCTGTTTCAGCTACAGGGGGTACGGTGACGCTGAGGTTCAAGGACTCTATCTCTGC
TTTCACTTCGCCACCAGCTGCAACGTTGGTGATCGAACAGCAGGAGTCTTATCAGCAAGGCTTTGCAACTTCGATCATACGAGTCAATGGTTCGCTGGTG
ACGGTATACAAGCTTCGCCACAATACTGGGTACGTCTTTCGAGCGTATTTCGTGAGCGCAAGCGGCTCCAAGAGTGCATCCAGAATCACTGCGGTGATTA
AAACCGGCGACACAAGGGCACCTGGAAAGACACCGCTTCCAATTGTGTCTCGTGTGACGGGTACGTGAACGGTGGAGTTTGACAATGGGATCTCTCTCGC
TCTGTCACTGATGCACTCCATGCTTTGCTTATACCAGGAGGATCGATTTCGATGTTGTTGCTGGAACCACTGGATACAGGTTTGTAATGCCTTTGCGTTT
ATGTCGGTACCGTTATTCTCTACACACCACTGGAGTTGTTGCGTTCTGACACATCTTGCTGATTATTGTGCTCGGTAGGCGGCCTTCCAATTGCGACGTA
CAATATCTTCATCGACGATGGCAGTCAATTTACAAAACTGACGAGCGTCACGGCGCAATTAGCGGGAGATAGCCAGACAGCAACGATATACCGCGATCTC
GATGGGACACATTTGAGTGCGTCAACGACGTACACATTTAAAGTGCTCGCGTTGCAACTTGGCGCAGTTTGCGAAAAGTTGTCATCATCTTCATATCTTG
AAAGTGATTCTTTGACCGTGTCGACGACATCAGCGTTACTTCCTACCCCACCGACACGGCCGTCGCTTCT