Description :
From Genome Similarity Track
Location :
contig_37:423192- 425098
Transcript NameFunction/comments
g9404.t1XP_009523725.1 hypothetical protein PHYSODRAFT_489267 [Phytophthora sojae

Sequence
1906 bases(100 bases per row)
GCCGGCAACCGCGGCTCGTACCAGCGCGCGGCGCCGGGAGGACCGTTCTACTACCAGCCGCCGCCGACTCATTACCAGCAGCGCAACGGCAGCGGATTGG
AGGAAATCCCGCTCACGTCGCAGTCCACGGGCGGCGTGTACGAGACTGTGGACCTGGACGCCGACAGCGGCCAGCAGCAGCGGCTATTCACGCCCAATGG
TCAGGCGCAGAGCTTCGGGTACAAGACGGCGACCCCACCAGGGAGTCGAGAGGCCCACAGAGCGCCGTTCTACCAGCAGAAAACCCCGGGGAGTACTGGA
GAGTTGTTTGCTAATGGGCCACCGCCCGCGAGAGAGCTCTTTGGCGGGCCTCCGTCGAGCTCTGGCAGCGGAGGGAACCCGTACCGACGTCAGTCGAACC
CCGTGAACAATTCAGTGGCAGTGAATGCGAATGGAGGCGCGATGTTTGGACACAGCGAGTCGGTGGAGGATCCGTTCACTGCGTCACCAGCGAATGGGAA
TGGAGCGGGTTTGATTGGACACAGTGCATCGCCGCCAAATGATCCGTTTGCTGCGTCACCGTCGCAGAATGGAGGGTTTGGTGGACAAGCCCCGCAGCAT
GACCTGTTCGCAACTCCTCCCTCCAAGGAGAAAAGGAATATGTTTGGAGGCGAATCTGTAGGCGCCAGTGCTCATGATCCTTTTGCGGTCCAGCGGCCGA
TGGACTCAGGCTTGCAGTATCAACAGCAAGGATACCAGCAGCAACAGCAGCATCATGAGCAGCTACGGCCGGCAAGCTCAGAGACGTCTGCGAGCCCATT
TGCCGCTGTCTCCTCTAATTCGGCTGCACCAGCGGACCCATTCGCTTCTGCTCCCTCTCAATCGACTTACGCATCGGTGGACCCATTCGCCTCCACTCCT
TCTCATTCGGGTAGCAGCCTGTTTGGTTCTTCTGCTCCATCGGACGGCGCACATCAGCGTATGGCGAGTGCTGACAGCCTGTTTTCGTCGCCTGCGCCGT
CAAACAACGGAGCTTGGGCACAGGCTACACAGCCCGAACCGAGCCCAGCACAAACGCAGAACGCATTTACCAGCGAGGCGCCTACTGCTAGCAGTTTGTT
TGGTGGTAGTGCTCCGTCACAATTTGAGGCGAGCCCCCCAGCACCATCCAAGTCCCAGATCTGTGCGTCGCCGCCACAGGTCAGTTTTTCGCCGTCACCG
GTGAACCCCCAGGCCGGCATCCCACCGTCGCCGACAAAATCTCCGGTCAACGTCCCACCCTCGCCAATGAAGCCTCCGGTCCACGCCCCGCCTTCGCCGA
TGATTAACGCCTCATCTCCGCTCATGAGACCTCAAGTTACAGTTCCCGCGTCTCCAGTGATGAGACCTGAAGACCATCTTACTCCTGCTTTCGGCTCCAT
GAAGCTATCAACTCCTGCTAAGTCCCCACTCAAGTCTGGCCTTGACGTACGGCACATGAAATTCCCCGCTGGTAAACGTGAAGACGACGCTGTTTCTAAT
GCCCCGAGTATGGCCCCGAGCCGGATGTCGATGCTGTCAACTTTGGATGACTCGCTGAAGCTCTCAGACATGTACAAGCAAATGACTGCGCGACTGGAAG
GAGAAAAACACGACTTGCTGAAGGTGGTGACCAGCCAGGCTCAAGAGATTGCCCAAATGAAGAAGCAAATCCAGTCCTTAGAGCTGCAGCTGAAGAAATC
CCGGCTTCAAAACGTCTAGTTGAGCTGCTAAAGGTGAACAAAGACGAAGGCCTGCTGCGCTTCCAGATATGAGAAGTGAGCTTTGTGTAGAGAGAATTGA
TGTGGTTTTGACAAAATCATCGACTCACCTGTGTGCTTGCCTGTGAGTGATTGACTTGGTATATCTCATGCGCAGGTGCTCCTGGAATGCAATCTTCACC
CTGCAG