Description :
From Genome Similarity Track
Location :
contig_37:423172- 425078
Transcript NameFunction/comments
g8976.t1hypothetical protein

Sequence
1906 bases(100 bases per row)
CCGCAGTCTTCGGGGGGCTCCTACAACGCCGGCAACCGCGGCTCGTACCAGCGCGCGGCGCCGGGAGGACCGTTCTACTACCAGCCGCCGCCGACTCATT
ACCAGCAGCGCAACGGCAGCGGATTGGAGGAAATCCCGCTCACGTCGCAGTCCACGGGCGGCGTGTACGAGACTGTGGACCTGGACGCCGACAGCGGCCA
GCAGCAGCGGCTATTCACGCCCAATGGTCAGGCGCAGAGCTTCGGGTACAAGACGGCGACCCCACCAGGGAGTCGAGAGGCCCACAGAGCGCCGTTCTAC
CAGCAGAAAACCCCGGGGAGTACTGGAGAGTTGTTTGCTAATGGGCCACCGCCCGCGAGAGAGCTCTTTGGCGGGCCTCAGTCGAGCTCTGGCAGCGGAG
GGAACCCGTACCGACGTCAGTCGAACCCCGTGAACAATTCAGTGGCAGTGAATGCGAATGGAGGCGCGATGTTTGGACACAGCGAGTCGGTGGAGGATCC
GTTCACTGCGTCACCAGCGAATGGGAATGGAGCGGGTTTGATTGGACACAGTACATCGCCGCCAAATGATCCGTTTGCTGCGTCACCGTCGCAGAATGGA
GGGTTTGGTGGACAAGCCCCGCAGCATGACCTGTTCGCAACTCCTCCCTCCAAGGAGAAAAGGAATATGTTTGGAGGCGAATCTGTAGGCGCCAGTGCTC
ATGATCCTTTTGCGGTGCAGCGGCCGATGGACTCAGGATTGCAGTATCAACAGCAAGGATACCAGCAGCAACAGCAGCATCATGAGCAGCTACGGCCGGC
AAGCTCAGAGACGTCTGCGAGCCCATTTGCCGCTGTCTCCTCTAATTCGGCTGCACCAGCGGACCCATTCGCTTCTGCTCCCTCTCAATCGACTTACGCA
TCGGTGGACCCATTCGCCTCCACTCCTTCTCATTCGGGTAGCAGCCTGTTTGGTTCTTCTGCTCCATCGGACGGCGCACATCAGCGTATGGCGAGTGCTG
ACAGCCTGTTTTCGTCGCCTGCGCCGTCAAACAACGGAGCTTGGGCACAGGCTACACAGCCCGAACCGAGCCCAGCACAAACGCAGAACGCATTTACCAG
CGAGGCGCCTACTGCTAGCAGTTTGTTTGGTGGTAGTGCTCCGTCACAATTTGAGGCGAGCCCCCCAGCACCATCCAAGTCCCAGATCTGTGCGTCGCCG
CCACAGGTCAGTTTTTCGCCGTCACCGGTGAACCCCCAGGCCGGCATCCCACCGTCGCCGACAAAATCTCCGGTCAACGTCCCACCCTCGCCAATGAAGC
CTCCGGTCCACGCCCCGCCTTCGCCGATGATTAACGCCTCATCTCCGCTCATGAGACCTCAAGTTACAGTTCCCGCGTCTCCAGTGATGAGACCTGAAGA
CCATCTTACTCCTGCTTTCGGCTCCATGAAGCTATCAACTCCTGCTAAGTCCCCACTCAAGTCTGGCCTTGACGTACGGCACATGAAATTCCCCGCTGGT
AAACGTGAAGACGACGCTGTTTCTAATGCCCCGAGTATGGCCCCGAGCCGGATGTCGATGCTGTCAACTTTGGATGACTCGCTGAAGCTCTCAGACATGT
ACAAGCAAATGACTGCGCGACTGGAAGGAGAAAAGCACGACTTGCTGAAGGTGGTGACCAGCCAGGCTCAAGAGATTGCCCAAATGAAGAAGCAAATCCA
GTCCTTAGAGCTGCAGCTGAAGAAATCCCGGCTTCAAAACGTCTAGTTGAGCTGCTAAAGGTGAACAAAGACGAAGGCCTGCTACGCTTCCAGATATGAG
AAGTGAGCTTTGTGTAGAGAGAATTGATGTGGTTTTGACAAAATCATCGACTCACCTGTGTGCTTGCCTATGAGTGATTGACTTGGTATATCTCATGCGC
AGGTGC