Description :
From Genome Similarity Track
Location :
Scaffold_1966:4231- 6340
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1966-snap-gene-0.6Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_1966-snap-gene-0.5Aspartate racemase
Pytar_ATCC12531maker-par_contig_1966-fgenesh-gene-0.3Conserved gene of unknown function

Sequence
2109 bases(100 bases per row)
CGTGCTGCACAACGACTATGGAGGCTCGAGAGGTCATGGTCGGTATCTGCGGCGGCGTCGGTCCTGCGGCGGGGCTGCTGCTCCATCAGATCATCGTGGA
AAACACGGACGCCAACGGCGCCGACCAAGGCCATCTCAGTGTCTGCCACTTTTCACGCTCGCACGACATGACGGACCGCACCGAGTACCTTCTGTACGCT
GCCGACCCGCTGCGTGGCAAGCCAGGACAGGACACCATTGAGAACCCGGCGCTCGGCATGGCACGCACGTTCGAGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTGCGGCGGCGGCGCAGGGCAAGGCGAAGCTCGTGGCAGGTGTGCCATGCAACACGTTCCACGCCAAGCCCATTTGGGACGAGTTCCTTCGA
CGCACTCGTCACGAGTCAGTGGACAATGCCGATTCCATAGTGTTCGTGCACATGCTGGATGAGACGGTGCGGTTCATCCAGCACTACGCGCCGACCTGCA
CGCGCATTGGGCTGCTGTCCACCACAGGCACACGTGAGTCGCGCGTCTACCACGACCTCATGGANNNNNNNNNNNNNNNNNNNNNNNNNNNGATCCCGCA
CGCGCTTCAGAACGAGCTCCACGAGTCGATCTACAATACGGCATGGGGCATCAAGAGCACGGCGCCGGCGGTCAAGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGTCGCAAACTTCTACCGGTACGCGAGGCTGCTCCAAGCATCCGGTGCCGAGGTCATTGTCATGGGCTGCACCGAGATCCCGTTTGCTTTCACGG
GCAAGAAGACCGCGGCCGGCCTGCTGCTGATCGACCCCATGGTCGCACTCGCACGTGCGCTGATTCGAGAAGCCGATCCGTCACGACTGAAGCGGCTCGA
CGGCGACGTCGACACGCCGTGGCCGCGCCAGACGCAGGCGTCCAAGCTCGTACCTTCTCCATGTGCATCGAATGAGACACGTACGAGAACGCTGCACTGC
CGGCAACCCAAGTGAGTCATGTATGGATACAATAGAACCCCCACCTTGTTCATTATTATTTCGGAATGCGATCACATGAACGACGCCGTGAACTGGTTCA
GGAATGCTGCCGCTTGAACAGCAGCGTCCTTGTCTTGCTGCGAATCCTGGACTGCTTCCAGAGTCACTGGCGGTTGCTGCTGGATGTTCTGTTGTTGCTG
CTGCTGCTTGAGCTTTTCGAGCCGCAACTGCTTGCGTCGCTGCTTCTCCGTCAACGCCGACGAGTTCGACTGCTTGGCATGCTCCACGCTCGCGTGGACT
TGCTCAAGGTACTGTTTTTCGTCCGGCTTGAGCGTTTTCTCCCACTGCGAGACGACAAAGGAGCCGCCGCTAGGCGCTCTGTCTTCCTCTTCCCCTTGAT
GACGATCGCCGTCTCGGCGTTTGTCCTCAAAAAACAGCGAATCGGTTTCCCCCCTCGTGCCTCGCTGCACGTACTCGACGTGGTCGCTACTGCCCTTCTC
CACAACACGCGTGCGCCCAAACTCGTCCGTGATCTCGACCGTCTCGGTCGCTCGCTTGTACTGCCCGTCCGCCACGAACGCATGCGAGTCTCCAGCTTTG
CGTTTCCCATCAAAATCCACGAGACAGTCTTTCGCTGCTGCCGCGGGCACAGCGTCGCGCTTTCCCTGCATCATCTGGTCGTAGAGCTCCGCTTTGCGAG
CGAGCATCTCACGCGATTTCTTTTGGAGCGCAGCGTCGTCGTCCGAGTTGTTCACGTCCAACTCGCGCAGCTCGTCGTCGCGCCGTCGCCGTTCCTCGAC
TCCGCGGTTGCTGTCCTTCTCTCGTGCACCTCGACGGCGCTTCTGCGACTGGAGGCGCGCGTACACGCTGTTGCCCATGGCACCACCATCTCCGTTGCCA
TCGCCATCACGGTCCGAACGCTTCCGGCGGCTCGAGCGTATTCCGTTGTCGCCGCCGGCTTCTTCGCGGAGCTGCCGCAGACGCTCCTTACGCTCCTGCT
CCTTCTGGAAGACGACGGCCTTGAGATCCAGAATCGACTTGGAGTCGACCTTGATTTGCTTGGCCTTGGACGGCAGCAGCGCCGACTCCGTCAGGAACCC
GAGCGACAT