Description :
From Genome Similarity Track
Location :
Scaffold_19:422921- 424642
Transcript NameFunction/comments
Physo_132140hypothetical protein

Sequence
1721 bases(100 bases per row)
GAACCGGCAGCCGGTTCGTTATCGTATTCGTTGGAGAGGGTTTCCGCCCCACCAAGATACATGGGAGCCGCGGGGCGTCCTGCTGCAGGACGTTCCGGAA
ATGGTGAGGGTGAACGAAGCTCACCACGCGCTGCCAGTGCGAAGGTAGAGCGAGCGCTGTAGTCACCTGCAGCGCCCGAAGTCCCACGATCGTCGCATTC
CTCACGTGCCAGGAACTTACTAGGAGATCTTTGAGACTCACAGGTACACGAATCGTCGTGTACCCGTTTGGGTCGCGGTCGCTCAAGCGCGCCGCAATCG
GAAGCCACAACGTGCACTGTTGGCCTTCGGGCACAGCGCATGGAATACTAGCGTCCACAGAGGATCTGTGGAGCTGCTCCAGCCGCCCGCGCGTCGAGAA
TGTCTCGAAGCGCTCACGGGCATGCTTAACCCGCTCGCGGTAAGCAGCCGGTTTCTTGTTGAAGTTCTCAACAAAAGCATTCCAACTTTGACGAAGTGCC
TGCCACTCAGGCACTTTGCTGCGAGAAGAGGTCTTCTTGCTGGAGACGTACCGGAGCTCGTGGAAGAGCCCGATATAATAATCGCGCCTTTGATTCGTTA
CCGGGTCAAAGTGCTGCTCCTCCGCCACAGCATCGTCGTGGATGCCGCTGCATACGTATAGCGGGATATCATTAGGAGGCACAGTGTTGCCCACACGGTC
TGCGATCTCTGACGCAGACGGTATCCACGGATCGCGCGCTGCTCAGGCAGCGCGCGGAGAGCTTGAAGACGCCACTTCACACGGGGAGCTTAAAGCCCCA
GCAGCAGAGAGCGGAGTGTCGCTCTCGCCGCGCGAACGCTTCAAACTCGAAGCGTCCGAGTCGTCTCCTTCACGAGGGCGTCTCGACCCGGCATGCGGGT
CGAGACTATCGCTGTCGATAGACTCCTTGCGCATGCTTGAAGAGGCCTCGCCCTCTTCCATCTCCACGTCGCAGTCCCCGTAGTCAACAGCGTCGTTGAC
TACAGAGGAACCTTCGAGGACAATCTCCGGTTGAGTTGTCCCCGCCGCAGCCTTGGCAGCAAGAGCGTCACGCTTTGCTTTGTGACGCTCGCGGTACTCG
GGGATAGAGAGAGTATCTATCTCGGCGGAGGTCTTCCCCTCTGCTGCAGCGTCGGTCTTCTTCGGCGAGCTCATTGCAGAATGAGCTCGAGTTTTCTTTG
TCCCAACCTGAAGAATTGACGAATGGTCAATTTGCTGATTGACGTGCCGTGACTCGGCGCGTCTAACCTTGAGGGGGGATGGTGTAACAGGGTTACACGC
ACAAGTGGCTACAGTCACTTGTAACTCTAACAGACACGACGTCTGTTAGAGGTTCGAAAGACTTTCTCGACCTTGGTGTAGACACACCAAAGGCTACATA
CATTTACGATCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAAAGCAGCATCTTTTAGCCAATGAGCGACATGCATAGCATTGGAA
TTCTGCCAACCAGCCGTTGGCAGATTCCTATCATAGAATATTACATTTAGAGGAAGTCAGAAAGCATAAAACGAAAATAGCAGTTCTCATTTCAACCCAA
AAACATTATTTGGACGGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAGTTTAAACTAAGCTACGCTTCCTCACACACATGCG
CGCACGTGTAAGCTAAAGTAG