Description :
From Genome Similarity Track
Location :
Scaffold_12:4229- 7061
Transcript NameFunction/comments
Phymu_g876conserved hypothetical protein

Sequence
2832 bases(100 bases per row)
CAAACGAATTCTCAAATTAGTGACATTGTTGGCGCCATTTCTTGGAACTTTGGTGTCGTCTGATGCTGACAAGGTGGGAAGCCGCACAGGCGGGTCTCCG
CGTGTTCTTAGAGGAGGACGGTGAATATGTACAGTTCTTGGAGAGTTTAGATCTGGACCTAGCGTGTAAGCTGCGCTTTTTGCACCGACAACAGGGTGAA
TCTCTTATGAAGACCGTCGCATTCGATCGGTTTGTGGAGGCTGCAGAGCAGCTTCGGTACCTTCATACGTTCTTTCAGGCGAAATTGAAGCTGGTTATGG
AGGCCTCAGTGTGTGGAGATGGTAGATCAGCGGACGAaaagtgcagcagcgttgtGGGGATTCTCGCGGATATGTTGAGCGTCCTCCGTGTCGTGTACAA
GCAGCTTTTTTGCAGAAGTGAAGCCACGCAGGCAGTATTTGAAGCAGCGTTAACGAGGAGGTCAGAAGACAGTGGCGTGATGGAAAGATATTTGACGACG
CAGCAACTCACTCCCGAGAAGCTAGTTGGACGGCCGTTAAAGCGGTTTGATGCCTTGGTGGAGTTTGTAGAAGCGCTGAGCAAGACTTTTGCAGAGGACG
GTAGAGATGGGTCCACGAGTAATGACAGCAATGCATCCACTGAAGCAAATGTCAACTTTGCTCCTCAGCTGATGCATATCGCCCAGGAGAACAAACACTT
CATTTATCTCGCCAAGGCTGACGTTCAAGCAGAAAACGAGCTGATTGCGCTTCAAACCAGATTCCACGGTGACGGGGCTGAGGCTTTTACTGATTTATCC
GATAACAAGCTACTTCTTCACGGAGAAATCTTTCTTTTACAAAGGAATCAAAGTGATCACTCTGCCGCAACGAGGTGGCTCGCTGAACCAGAAAGGATTT
ACGCGCATTGCTTTCAGGACGGGACTTTAGTGTGCAGCAAACGGCAGAACTCTGCATCAGGGGAAATGTTCACGATTCTGCGTTGTCTGCATCTCAAGCA
GGATGCTGCATTTCTCGAACACATTCCAACCAGCGTGCCATTTCGTGGGTCTTCTGATGAAGCGCGTGCTTTGGCATTGATTTTGCAAGACGTAACGCTT
GTTTTTGCCTGGAATGACGCTACGGAGAGTCAGCGATGGACTGACGCCATTGGAGGGTTTCTGGAAATGAATGGGTCGCGTCTTGAAGTACTTCGCCAAG
GTCGAGCGATCAGCAACATTCCTGTGTCCGAGGAGATTACAACACAACTTGTGGAAGCAGATATTATCCCAACAGAGTTTCCGTCCTTTTACGACGACCA
TCTTCCTGGAGTTTTCTGGATGGCGCCCGGCAAGGATTCAAACCCAAGTACGACCCCCTGGGAGTTGGTTGAAATTGTCTTCTATGCTAGATGGCTACTG
GTGTTCGAGCTAAACGGATGGGGTGGACACTCAGCTTTATGCCACTTTGACACCTGTGCACCTGAGATGGAGATTGGCGAGCAACCACGTGGAGATAAAG
AGTGGAGCCTGGTTATTTCCAACGGGACTGCAAACCGACTTACTCTAGTATCGAAAAAGAGGACAAGAATTGATTTCTGGTTTGATCAAGTGTGGAAGGC
CGTTGACAGTGCTcaaactgcagctcgacgGGCGGAGAGGGAGAAAAGAGAGCGGGAAGAAATGGAACAAGAAGAATCCCACGCACGTGGTAACACCAGA
AGGCGAGGTGGACACACTGGGAAGAAGCGCGCACTCAAGGTTATATCAAGCAGCGGCGAAAGCTCGGCAGATGAGAAACCAAACTCGTGCATAAATCCAA
GCCCGACAGGGTCCAACATCTCCAAGCCAGATGATAAGACGGATGAAGAATGTGGTGAGCAGGGCAGAGGCACTTCAGTGACCattgcggaagaagaacc
caCTACTGCAGCCCCGGCGAAAAAGAAATCGCGACGTTTAACCGAGACATCGAAACAACACTCCACTACGACGTCTGTCCAAGAGGGTATCACTTCCGCT
ACCATCGCCTCACCACCGATGAAAACTCCGAAGAGAAGGTGGTTGAAGAGGAAATCCGAGGACCCAAATGACACTACCCTACTGCCAACTCAGCCTAGTC
CATCTATCCCAACCGACGAGTCTACGAGCGAGGTTGATGCTACCCAGCTTCCTGCTAACGAATCCGCTGATGAAGAGCCGAAACCCCAGGAACTGCGGAT
CATTCTCACCGGTATTGAGCCAACTGCTGCGGTCCGAAAGAAAATTGATTCGATTGTGGGAGCCGTCTACGAAGAAGATATTGAGAAGGCAACGCACATC
CTCGCCCCAAAGAACCAACTTAAGCGAACCGTAAAGCTGCTTTGCGGTATTTCCCGCTGCACTCACATCTTGGACGTGCGATGGCTCGACGAGTCAGCTC
GTGTGGGTGCTCCTGTGTACGAGCGAGCGCACTGCTTGAAGGATGCGAAGGCCGAGGCAAAATGGCATTTCGACCTCCGGAAAACCATGTACGACGTTAC
CCTGAaacagcggcagcagctcttcgccgGTCATCAGGTGTTCATCACTAACCACAAGTCAGTGCTACCGCCGGTGAAGGACCTAGCGAAGATTGTCGAG
TGCGCAGGTGGAATTGCCGTGATGAAGGGCAGCGCCGGCCCGAACGATGTGGTGATCACGAGTGACGTTGCGCTGACGACGGCCTCCGTTCGCAAGGCGC
TGACGCAGGCAAGTCCGCAAAAGATTTACTCCACCGAGCTGGTTTTGAGCAGTATCCTACAGCAGCACATAGATTTTGGCAAGAACCGCCTTGAGCAGTc
aggtggtggtggtagTCGCCGGCACAGGTAGA