Description :
From Genome Similarity Track
Location :
Scaffold_42:4229- 6055
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_42-fgenesh-gene-0.3T-complex protein 1 subunit zeta
Pytir_DAOMBR486maker-pir_contig_42-snap-gene-0.45Gene of unknown function

Sequence
1826 bases(100 bases per row)
GGACGAGCGCCTGGACAAGGATATGAATATTGCGGTCATCTTCGCAGGTATTTTTTTCTGTTGGAAGCGAAGCTGTTGGTGAATGCGGACTGTCAAGAGT
GAGTGACAGACAGACCGCTCAGCCCACGAGCTACCTTGAGAGGCTTGCTCGTAATACTGCAGCAGTTTCGCGAGAAATGGAGCACTGAAGATAGAGCAAC
GACACGTGCACGCATCCGATGTTTAAACCACGCCATTCTGGCAGATCGGAAGGTTAATCCGTTACATGTATTGTGATTTTGACTGAAAGGCAACCTTTCA
ATCAAAAATCACAGAACTATACAGATACACATTGCCGGATAATTTCGCCATTCCCAATCAGCACAGTACCGTATAAAGTCGCTTCAAAGAGCGAGCTCTT
CTAAACCCAATTTGCTCTTATAAGAGCGTGCAACACACTACATGCAAAACTGACTGTACTGTAGCGCTTGTATGAAACGATCCAGATTGATCCAAGTGGA
GCGCTCCACATGGAGCCCTTGCCCCTCCAAATCCTCACCACATGATTGGCCCAAGCCTGGATCGCTCGCTCGCCCAAAAGAGCAGGGGGCTCTTTCTTTC
CTTCATATCCCAGCCAAGCAGTCGCTCTATCACCACAGGCTTTATTAGCAGCTACAGATACAGAAGAGAGCCACCACCATGAACCGCGGCATGAACCCGA
ACGCAGAGATCGTGAGCAAGTCGCAGGCGCTGCTCGTCAACGTGAGCGCCGCCAAGGGCCTTCAGGGCGTCCTGAAGTCCAACTTGGGTGCGTTATTTTG
GCTGTTTCTACATTGTTGTGCTGCTCACAGTGCAACACGATGACGATGCTGATGCGATCTTTCCCACGAGCTTCTCGATGGTGTTGCGACTGATGATGCG
TTTTATTAACGAATTGCTGGTTATGTGTATATGTGTGCGTAATGTACGTGAAGGCCCTCGTGGTACGCTCAAGATGCTGGTCGGCGGTGCGGGCCAGATC
AAGCTCACCAAGGACGGCAACGTGCTGCTCCACGAGATGCAGATCCAGCACCCGACCGCGGCGCTGATCGCGCGCGCCGCCACCGCGCAGGACGACATCA
CGGTACGCTCCGTAGCGGTGAAGAATATGCATCTGCGCTTGGTGTTCTATCGCTAACGCTACTTCATATCCCTGTGTGTGTATAATTGAAACAGGGCGAT
GGCACCACGTCGACTGTGCTCTTCATCGGCGAGCTGCTGAAGCAGTCGGAGCGCTTCCTGGCCGACGGCCTGCACCCGCGCATCCTGTCGGAGGGCTTTG
AGCTCGCGAAGGACGAGGTGCTGCGCGTGCTCGAGTCGCTCAAGGTGGTCAAGAAGGACATCCTGAAGGACCGCGAGCTGCTCTGCTCGGTCGCGCGCAC
GTCGCTCCGCACCAAGCTGGACCAGAAGGTAGGCCGGCATCATGAGCCTATCATCAAGATATAGCCATATATTTACTGACATCTTTGTGATGTTGTGGTT
ACAATAGCTCGCCGACCAGTTGACGGAGATCGTCACGGACGCCGTGCTGACCATCGCGCAGCCAGGCCGCCCAGTGGACCTGCACATGATCGAGATCATG
CACATGATGCACCAGACGAGCAGCGACACGCGCCTGATCAAGGGCCTCGTGCTGGACCACGGCTCGCGCCACCCAGACATGCCGACGTCGCTCGAGAACT
GTTTCATCATGACATGCAACGTGTCGTTGGAGTACGAGAAGAGTGAGGTGAATTCGGGCTTCTTCTACAACAGCGCCGAGCAGCGCGAGAAGATGGTCGA
GGCCGAGCGCAAGTTCACGGACGACA