Description :
From Genome Similarity Track
Location :
contig_110:42283- 43617
Transcript NameFunction/comments
g13734.t1hypothetical protein

Sequence
1334 bases(100 bases per row)
AAACCGACGTAACGGGGTACACCGACGTGTACCCATGTTACATAAAGAGTGACGGGATGTCTCTCTTTTGTGCCCATGGTACGTGGTACCGGTTGGCGGT
GAGCCAACCATTGGTCACTTGTTTAGCTTTTACTATAGTTGATTTAGAGTTTGTAAGGATCAAGCTTGGCTCACCTATAAAATATATTCAGTCTTTAATC
CTACCGTCTAAGTCGTAGTCGGTTCCCTTAGACCGGGAACCGTGAACTTGTTGTTCACCGAGAGCTTACGCTCTCTAGCACTTCATCTGTGCAAGGTGCT
GTGTGCCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCTACGCGGGTAGGATTGGACTACCTGAATCCTCTGTGGTCTCAAAGCCTGAGCCACT
ATGTAACGAAGTGAGTTTCCTCACTTGGACGACTCGCAGTTCGAGTCCGTTCGAAAGATGGGAGGCATCTTTGGGAGGGATGTCCTCCGAGGCTTGGCGT
CGGTGACGCCAGCCGAGCAAGTCGAACGCGTTCACGCGTTCGACACGTATGAGCGTGAGCTCATTGCTCACGTGCAGGGAAACCTGCAGACCTCTGTGGC
CAAGCCGAAGCCGGTCCAGCCGAAGCCTTTGCGGCTGGCTGTGCCTGCGTTCGAAGGGAAGGAAGGTGAAAACCTTCACTTCTGGATCCGAGAAGTTGAG
ATTGCCATGAGGGCGGGTCTCATCTCGGATCAGGGACTTCGCGTTGCGTTCGCGTTGTCCAACCTAAGCGGTCGTGCCAAGAATTGGGCATACACGCTGG
AGACGACGTCTCCTGGATGCTTTGCATCCTGGGGAACAGTTGTGCGAGCGGCTTCGCGCTGCGTTTCTCCCGGCGAACGATGCGTTCCGCCAGCGCTCAC
GCTTCCTCACCTGTAAGCAAGGGAAGCGCGAGCTGTACGAGTACGTACAAGAGATGCGCACGTTGGCATCATCGTTGGTGGGGAACCCCCTGCCCGAAGA
CGTCAAGACGACGGTCTTCATGGACGGCTTGAAGGTCGGTCCCGCACACACGCAGTTATTCCGCGTGCATGCATCCACTATGGAGGAGGCGATTAAGCTC
GCCCTCCAGGAGGAGTACAGCCATAAGCAGGCTGGTACTCCGGTTGTTGCGCAACTTGTCGTTGCGAACAACGAGCCAGAGCCTATGGACTTGAGCTCTG
CTGAGCTTGGCTCGGTCCGCTGCTATAAATGCGGCGGACTAGGACACTACCAACGTGTGTGTCCTTCGACTGGGGTGGGGGAAGAACCCATCCCTCAAAC
CCCGAGGGCCTAACGGTCGCTGGCGCAAGCCGCG