Description :
From Genome Similarity Track
Location :
scaffold_297:4227- 5737
Transcript NameFunction/comments
g6963.t1 DNA repair protein XRCC3

Sequence
1510 bases(100 bases per row)
CAGACGAAAGACGGCTGCAACCGAGTCCAGCACCACTAGCTTGGTGTTTTGTTCAGCTAACAATGCCGGAAGCCTGGCTTGCTGCAACACCACAAGGACA
ACGTCAGCGTATAATTGGTACAAATGTCAAACTACATTAGTACATACGACGAGATCCATTAGATCGTTGACAGTGTAAAGTTGTTCGACGAAAATGCCAT
CCAGGAAGTCGCTGCCTGTCAACTTGGGCGATGGTACGTCTCTCTTCCGTTTAGCTCCAACACCCATAACTGCTCCATATTGCTTGGCATACAGCTGAGC
GAGATCGTGCAGCCTTTTGACGGAGCCCACGCCCTCCGTGCAGATGTAACAGGCGGTTCCTTGCAAGCCGCCGAGAGATCGAGGCAGACAGCACTGTAGT
AGCAGCTGCAGACACAGCTGTGTCTTGCCCGCGGAAGCTTCGCCGCAGATTTCTGTCACGATGCCGGAGCGGAAGCCTCCCTGCAGCAGTTCATCGATTG
ACTCGCATCCAGAGGGCAGCACGAACGACGTCGAGGCACGCGCTTCCCATAGAGCCAAGGCCGTCGTCGTCGCATCCGCCATGGTGAACAGTAACATGTC
ATTAAAGAGGGGATTACTGGCGAATACCGGTACGCTATATACCAGGATACATAGGCTGTTACATAGGTTTGTAACGGTTGGCTGGTGTTTCCTGCGTGCA
CCGCCCTTCCCTCCTTCCTGCTCATTCCTGAAGAAGCTCCTTTGGAGTGTGAAGGCCGAATTTAGAGCGAAGAAGGAGCTGATGTCTATCCTGAGGGGCT
GATATCTAATGATCGACAGCATACCCAAGTCCAGTACGCTGGCCTGATCCTTCCATCCAGCAGCGTTTAGCTGTTCATGTTGTGTGCATGCAGTCACATC
TGCCACAGTTGTTGCGTCCTCCTCCATGGCCAACCATACTGCTATTGGCTGCATATAACAAGCGGCAGTTCATGATAGGAACCCTTGCAATTGATCCGTA
TTGACAAGGAGCCAATTACGGCCCACATGCATTCAATCCTACCTAAATTCTATCTAGTAGCATTTACACGGCAGTCAGAGTAAGTTCTTCGTCGAGTAGA
GAACAACGCCATATTTACAGACACGCAATATCGATGCTGTAGTTCTTTGGAATCTACGGCTCAAAGCCTTTCGCAATCTGCTGACGTCTGAGTCCTAATT
CGCAAGATCGTTCAACATGACCTGAGCTCTATTCGTAGTCAGGCAGAAAGAGGCTTTGATGCAAAGTGCGAAGTGCTGTGAGGGTCAACGGTATTTGGAG
TGACTTGCAGTGGTACATATCGCCTCCTGCTTTCGCGGCACCACAGCAATCACTGCTTAGAGCGTTCGTGCATTCTGCGTGGCAACGATATTGAAGTGTG
AGGTGGAACACTTTCGCGGATATCGTTGAGCGATTCTGGTCCTGGGCTGGCGGTGCGTATGTTTGCTTGGAAGTTCCAAGCAAACATACAGGAAGACTGT
TTCCGTCATG