Description :
From Genome Similarity Track
Location :
scaffold_54:42268- 44271
Sequence
2003 bases(100 bases per row)
CGGTAATTGCGGGTGTCGCAATTCATTCATAAAGAATAGCGTAAATTTAATCGATGAATGAACTGaattgttcaaagcaaactcAACCGATGGTAATAAC
AAGCTCCGTTCCGAGGAGTGTTCCGCACGGAAACGTCTCAACACATTACCGATCACTCGGTGGTACGTTCTGTTTGTCCATCGGTGACCGGCTGTACCGC
TGTGACTTTTATCCAAGCGAGTGCCAAAAATCGGAACAATTCTTTCAAGAGACACACTGGAATCGTGTATCACGATCAGAGATGATGGCGTCCGGCAACC
CGTGATTGTGAAACTGTGATTAATGAAAAAATTGTCGAACCTTCGGCATCGTTGAAATCACTACACGGAGCGAttcgaaccatcttgctgagtctgtTAG
CAAAGACGAGTACCCTGTTTTGACCATCAGCGCTTTTGGGAGGCCAAAATAAAGTCGAGAACGGCTCAGTTTAACAGTCAGTAGGAAGAGGAAGGCTCTG
CAGCGGCACTTGCGTATGCCGTGCGCGCTTCACACGCTGATAGACATCGCATGTCTTTACGTATTGTGCCACCTTTTGTACATGTGGGGCCACAAAAATT
GGGCAATGAGAGACCTGAAAGTTTTCTCACAGCCAAAGTGGCCGGTCATTGGCGTATCATGCGCCTCGTACACTATCTTGTACTTCAGATTAATGTTAAG
GGAAACCGAATTCGTGGCTCGTCGTCACGTGTAACGTTTTGGTGAAGGAGGCCACCCTTCAATGTATAACGACGCAACCTTAATTTCAAGCGACCAGCAA
GCTTATCATGGAATTTCACACCATTCGACGACAGTGCTCTGATGATCAGATTACACTATTCATCTTCGACATACgctcgacgtatcatatCGAATACATC
GTTTTGACAAAGCTGTTATAAGTTTGCTCATAATCAGGACGTCGTGACAATGCGTCTACCAGCATGGCTAGTTTCCCTGGCATATACATGACCGTAAAGt
tgtattctgcaaagaatgacagCCAGCGAGCCATTCGCTATGACAAGTGATGCAACGAGCTGCATAACTCATAACTCTTTCTTGCGTGATCCGTGTAGAC
AATTAACGGAGTTCAACCCAAGAGGTGGACATTGATCTTCACCAGCGTATATTTTATTGCCAAAATCTGTTTGTTGAGGACAGAAGAGTTCTTTTCTACT
GGATTCAGCTGTCGTGATTGAAACGACACAACGAGATCGTGTCCTTCTGAgtccttttgcaatattgCGCAACggattgcaaactcaaaagCATCACACA
CCACGTTATGCGGCTTTGTTTCATCTAGTAAAGCAAGCAATCATACTTCCATCAAGCTGTTCTTGGTTGAGTGATTGCTTCTTCACACCAACATGACACC
GAGGACCGGTACTTCGTTAGCATCGAAAATAAactttgcaagatttgcTTGCATGGAGTATTAACGCATACATTCCAGCACTGCACGGAAATGCTCTGAG
TGCACTTTTTCGGCAGATCAACCGCGACGCTACCTGCGAAGCGTTGCATTGGTTAAAGCGGATGGGAGACTAATCGATTAGACGTTGCTGGGGCATTGAA
TAGTCCCTATGACATCACAAGCCCCTCCCGTATCATACTGGACGGTGTACGTACAGCCGTCAAAGAGACGTCCTCCTCTCTCATAAAGATTTGTAAGTAT
TCGACGAGCAAATCAACTAAACAAACAGTGTACAGCATCCGGTGGATGATGACATCTTTACGCGGAATCGACGTTTGCGCGCGAATCCTCTGATAAAGGT
GTGAACTCACGCCATTTGCCATTTGGTTTacgcacacaaaacgtcgATGCACTGCGAGGAAGCTTGCTCTCCCACACCaaaccagcagcttgcttCTAAA
CAAACAGCTCAATGATATGCTCACTTTGCTCACGTGACAGTAACCACGATCGAAGCACTGCATGCTTTGAACCAGGTTCACGATCACTTTTGTGTCGAAC
TCC