Description :
From Genome Similarity Track
Location :
Scaffold_391:4226- 5671
Transcript NameFunction/comments
Phymu_g9419hypothetical protein

Sequence
1445 bases(100 bases per row)
CGAGGAGCGGTCACTTAATCCGACGTGGATCGTGTACTCGTCCGTCGCTATCGCCATGCTCGAGGCCTTCCACTACGGTTGGTCCAACTCCCAAGTCAAc
ctcagcaccttcagcaacACGGACGACTGCAACGCGCGTCCAGTGGAGGAAGGCACCTGCCTCATGTTCCCAGGCCACACCaagacgacgtggacgctcC
TGGTGAACGCGTGGATCGTGGGTGGCATGTTCGGTAGTCTGCTGTCCGGCTTCCCGTCCAACAAGTGGGGGCGTCGTACCACACTGCGCTTCAACGCGAT
CATCATGGTGGCGGGTTCTGTGATCCAAGTGGTGGCGAACAACCCGACGTGGTTCGCTACGGGTCGGTTCGTGACGGGCGTGGCGAACGGCGTGGCGATG
GCCGTGGTGAACACGTTCCTGAACGAGATCTCGACGCCGCACAACCGCCACGCACTGGGCACGAACACGCACTTGGCTGCGACGTTGGGTATCTTCGGCG
TGGCGACGACGTTCTGGTACTGGAACACGACGTCGGGTTTCCGTTGGATCGCTGGTATGCCGATCGTGTTTGCTGCAGGGTTCGTGGTActgtcgttctt
cttcatggtcgAGAGTCCCGTGTGGCTGGTGGCTAATGGCAAGGATGAAGAGGCTGAAAAGGAGCTCGGCCGGTTGTATGGCAAGCAGAACGTTAACGCC
ATGATGGGTTGGATCCAGGCGAACGACCGTCGATCCAAATTGCCGTCGATGCTGAGTGGCATGTCTGATAAAGTCCACACGGAGACCAACTGGACGATTC
TGACCAACAAGAAGTTCCGCAAGCCGTTGGTTATCGCTCTTGGACTCACGTGCATCAACCAGTTGGTGGGcatcaacgccgtcttcttctactCGTCGTC
TATCCTGAAAGACGCTGGCATTTCAGACTCACGTGTTGGCCTTATGATCATTGACATCCTCAATGTTGTTCCCGTTCCtatcgctgctgcgttgaCCAAG
GTCATGCGCAAACGTACCATGCTGATCTCCGGTATCTTCGTCATGGTATTGTGCTGCATCGGAATGACCTTCTCGCTGGTGTACAGTGTCGGCTGGCTCT
CCATTGTCTTCCTCGGTATCTTCGTGGTGGGGTACGACCTGAGCATTGGTCCACTTCTTTGGCCGATTGTTGCTGAGCTCTTCGCGGATTCGgctcgagg
cgctgcagtcggtATCTGCATCACGATGAAGTGGATCTGCTCGCTCATCGTGGGCATCGGCTTCCCGtacgtggaggaggccatCACGAACTACAGCTTC
ACGCCTTTCCTGGGCACGACCATcctctccatcatcttcatctaCTTTATGGTGCCGGAGACGTCGGACATGACCATTGCCGAGATCCAGGACGGGTTCC
GTAGCGACCGCAGTGTGCAGTCGTCTAGTAAGAGTCAGGTGTAAG