Description :
From Genome Similarity Track
Location :
Scaffold_395:4226- 5503
Transcript NameFunction/comments
g17683.t1hypothetical protein

Sequence
1277 bases(100 bases per row)
AGTCGCCACGTGTCACCAACACAGGTATGTCGATAACATCATGCTCTGACACAGACGAATGGGTTATTCTAACTTTCGCATTATGCAGGATCTGGCTAAG
ACCGACAAAGTTAAGGACATGGGACTGTCGAGATTCGACTCCAGCAAAGACTACTTCTGCTCATCATGCACATACGCAAAGTCGCACCGTAACCCGTTCA
ATAAACGATCCGTTGAAAGGGTGAAATTCCCTCTTGAAAAGGTCCATACCGATATAACTGGACCATTGCTAGTTGCAACGCTCTCGGGCTGCCATTACTT
TCTCACTTTCATCGATGACTTTTCACGCTATATGTTTATCTACATCATCAAGCGGAAGTCAGACCTCTACGAATGCTATTAGAACTTCAGAAGGAAGCTC
GTAACGTGTTTCGCGCTGACGTAGGCCAGATCGAGTACACCGAGAACATGTACGATGAAGAAATCCGTCACCTCCAAAGCGACAGCGCCCGAGAATACGA
AAAGCTCGGTCGAATCATCTTTGAGAAATACAACACACACACAATTCACGAATGCCTACACCCCTCAGCAAAATGGGGTCGCAGAGCGAAGGATGCGCAC
ACTACTTGAACGAGCACGAGCCTTCCTAATTGATGGGAACTTACCGCACGTCTCTGGGGAGAATGCGTGAAACATGTCACTGATCTCCTGAACATCACTC
CAAGTTCTGTTACGGACAATATCACTCCCCAGGAAAAGTGGTTCAAGCGCAAACCATCCACACACTACATCAAAGGCTTTGGGTGCGCGGCATATGCGCA
CATTCCAGAACTCTATCGAACCAAATTCGAAAAACGAGCAAAGAAATGCATATATCTAGGTATTCCGTCGAATAATAAGGGGTACAGTCTTATCGACATG
ACCGAAAATCGGATAATCTACAGTAGGGATGTTCAGTTCCGAGAATAGGAATTTCCTAAGATAGAGTTTCTTCAATCTCCAACCACGGGAGACCTACTCA
GACCTAGCGCTGAAACTACAGCACCCACACGACAACCACTACCATCTATCGTTGAAATGCTCAAACGCAGCGCGACAGCACTTGCAGCTGACGACAGCAA
AGGTTCGAACAAAAAGGCAAAACACGCCCAAGAACACATGGATCTAATACATCCCCTCAATGATCAACTCGATGTGGAGGAACGACGAGCGCTGGAGAGA
CAAACGCACTCGTTGCTGGCGATCCGACACATTTCGGAACCAAAGACATACCGAGAAGCAATGCGTCTACCGGAAGC