Description :
From Genome Similarity Track
Location :
scaffold_20:422522- 424690
Sequence
2168 bases(100 bases per row)
cgggacgcgaggattaataagtccgttcaagtagaacgatatgtagccagtagacgcatgcacaacattgttcagagcaaacctGACaggtggcagcatg
gcgctctagcgcctcggcgcatcagcgcagacgctgcgaaggacgtcttcaacgatgcaattcacgcgctcagttttaccatcggtctgcggatggtccg
ctgttgacatatccaacttagtgcccagcaccctgatgatcatcgaccaaaacttctcagcgaagcgtgggtctttgtcagagacaattgactccgggag
gcCATGTTATAAAAGACacaatccacaaacagcatcgctgtacccccaccgtcgatggtgtccggcaccaccGCAAGATAAACCATCTTGTTCAAAGGCA
CAAAGGCCAtcctcatggactgccaataccAGGAGAAAACGGGTAGACTGAACAGCGGCgtcgccgcatttggagaggggtTTTAcgctttgacacgtct
cacacgtgcataCCTATGTGCCCGTCCGTttatacagcttgggccaccagttgtggcaactcacagagctgtacgtcttctcacgactgagatgaccact
tagtggggtgtcgtgggcctcatagaggatacggtacttcaaatcctcatcgtgaggaaccagaATTAGTGGCGAATCCGTTttatcggtgctataatac
agcaacccatcATTCAATGAATATTCGTGCAACTGTGCACGCAATCGCGCCGGAAAATTCTTGTCGGAGTTTAGAACTCCTTGCTTccaagagcccgtag
cagcggtacgcatatcatcacccgtgtGTGTGGTgcgaatcaaatccgtcactggtgacgtcaccgtcgtgacatgagcaaactCGTAATCTGGTTTGCG
TGacgacgcatcagccaaagcattctgctttactGGTTTATACTTCAGCTCAAATTTACATTCTGCAaggaatgagagccacctgaccatcctctgcaaa
aGGCAAGGTGACTGATTGGCAGTGCGcactgacgcatgatctgtgtggattacaaacagctttgagccaagcaggcgcACTCTGAAtctgacaagtgcat
aattcattgcaagtatttcgttgtcgtggactgggtagttactctccgcagccttaaacaGGCaaaattcgaacgcgataacccgatctcgcccctcggc
gtcagcttgcagcagtgcacagccgatggcgaagtccgaagcgtcacagacgacagtAAAAGGACGaccggggtctggcaacgccagcattggtgcatga
agaaggctgtctttcACCATATCAAAGCTTCCCGATTCTCGGTgccccaacaccattccataCCCTTCTTAGTAGATTTGGCAATGGtcttgccatttcc
gcatcatttgcgctatacatgtgcaagtagttggcgagaccaagccacatgTGCCACCAGCCCACGATGGTCTCGACCTTAGCAGGATACGCTTGAAGCC
CGCGCCCCCCGCTGAGGCGCCCTAAAGaggatttcttccgcgccgaagatgaaCTTATCTGTATTAGCATACAGTTTGTGCACTCGAGAAaaagacgatg
tggttttccccATCTGTCtttccgtgctccgcacgaatgtggacgaagatgtcgtcgaagtatgtctgtgcatacgctctGTGGGGTCTAAACaagtgcg
tcacaagacatttAAATGCTGATGgcacatttgacagcccttggggtatcatcagccactcccagagcatcccgctcgaagtactcacctCTGTCAGCGG
AAAagcactcgctctcatgagcaatccataataaccatcgaccaagtcgaatgcGCTGTATtgtgtacagccaaccatattgttctggagagcattttta
ttagGTATCGGTGTCTGTGCCAGACTAGTGGCAGCGTTTGGCTTATTGTACACGTGAATGATACGCActaccgttcggcttccgggcacAAACGTGTTTG
TCGAATGAGGAGACCTACTCTCaggcaccattcctgcgtcgtgctttgcacggaaaaaagcgtcaatgacgtcacactgctccttgggcagagatcatcg
gcgtgttacgcagtatttggttcccggaaccaggtcaatctcgtAACgcgcacctcggtccggagata