Description :
From Genome Similarity Track
Location :
contig_37:422512- 424417
Transcript NameFunction/comments
g7644.t1hypothetical protein PHYSODRAFT_489267

Sequence
1905 bases(100 bases per row)
ACGGGCGGCGTGTACGAGACTGTGGACCTGGACGCCGACAGCGGCCAGCAGCAGCGGCTATTCACGCCCAATGGTCAGGCGCAGAGCTTCGGGTACAAGA
CGGCGACCCCACCAGGGAGTCGAGAGGCCCACAGAGCGCCGTTCTACCAGCAGAAAACCCCGGGGAGTACTGGAGAGTTGTTTGCTAATGGGCCACCGCC
CGCGAGAGAGCTCTTTGGCGGGCCTCCGTCGAGCTCTGGCAGCGGAGGGAACCCGTACCGACGTCAGTCGAACCCCGTGAACAATTCAGTGGCAGTGAAT
GCGAATGGAGGCGCGATGTTTGGACACAGCGAGTCGGTGGAGGATCCGTTCACTGCGTCACCAGCGAATGGGAATGGAGCGGGTTTGATTGGACACAGTG
CATCGCCGCCAAATGATCCGTTTGCTGCGTCACCGTCGCAGAATGGAGGGTTTGGTGGACAAGCCCCGCAGCATGACCTGTTCGCAACTCCTCCCTCCAA
GGAGAAAAGGAATATGTTTGGAGGCGAATCTGTAGGCGCCAGTGCTCATGATCCTTTTGCGGTCAGCGGCCGGATGGACTCAGGCTTGCAGTATCAACAG
CAAGGATACCAGCAGCAACAGCAGCATCATGAGCAGCTACGGCCGGCAAGCTCAGAGACGTCTGCGAGCCCATTTGCCGCTGTCTCCTCTAATTCGGCTG
CACCAGCGGACCCATTCGCTTCTGCTCCCTCTCAATCGACTTACGCATCGGTGGACCCATTCGCCTCCACTCCTTCTCATTCGGGTAGCAGCCTGTTTGG
TTCTTCTGCTCCATCGGACGGCGCACATCAGCGTATGGCGAGTGCTGACAGCCTGTTTTCGTCGCCTGCGCCGTCAAACAACGGAGCTTGGGCACAGGCT
ACACAGCCCGAACCGAGCCCAGCACAAACGCAGAACGCATTTACCAGCGAGGCGCCTACTGCTAGCAGTTTGTTTGGTGGTAGTGCTCCGTCACAATTTG
AGGCGAGCCCCCCAGCACCATCCAAGTCCCAGATCTGTGCGTCGCCGCCACAGGTCAGTTTTTCGCCGTCACCGGTGAACCCCCAGGCCGGCATCCCACC
GTCGCCGACAAAATCTCCGGTCAACGTCCCACCCTCGCCAATGAAGCCTCCGGTCCACGCCCCGCCTTCGCCGATGATTAACGCCTCATCTCCGCTCATG
AGACCTCAAGTTACAGTTCCCGCGTCTCCAGTGATGAGACCTGAAGACCATCTTACTCCTGCTTTCGGCTCCATGAAGCTATCAACTCCTGCTAAGTCCC
CACTCAAGTCTGGCCTTGACGTACGGCACATGAAATTCCCCGCTGGTAAACGTGAAGACGACGCTGTTTCTAATGCCCCGAGTATGGCCCCGAGCCGGAT
GTCGATGCTGTCAACTTTGGATGACTCGCTGAAGCTCTCAGACATGTACAAGCAAATGACTGCGCGACTGGAAGGAGAAAAACACGACTTGCTGAAGGTG
GTGACCAGCCAGGCTCAAGAGATTGCCCAAATGAAGAAGCAAATCCAGTCCTTAGAGCTGCAGCTGAAGAAATCCCGGCTTCAAAACGTCTAGTTGAGCT
GCTAAAGGTGAACAAAGACGAAGGCCTGCTGCGCTTCCAGATATGAGAAGTGAGCTTTGTGTAGAGAGAATTGATGTGGTTTTGACAAAATCATCGACTC
ACCTGTGTGCTTGCCTGTGAGTGATTGACTTGGTATATCTCATGCGCAGGTGCTCCTGGAATGCAATCTTCACCCTGCAGCTCGCGTTCGTTTCAACACT
TTGTATTCTGAGACTCGTTGAAACCGTGGGTGAAACATGCATGGAAAATAGCATCGTGCTGTCGGGTTGCAAGCGAGGAACTCAACTTCGGTCGTGGCTG
AGCGC