Description :
From Genome Similarity Track
Location :
contig_110:42250- 43580
Transcript NameFunction/comments
g11224.t1hypothetical protein

Sequence
1330 bases(100 bases per row)
AAACCGACGTAACGGGGTACACCGACGTGTACCCATGTTACATAAAGAGTGACGGGATGTCTCTCTTTTGTGCCCATGGTACGTGGTACCGGTTGGCGGT
GAGCCAACCATTGGTCACTTGTTTAGCTTTTACTATAGTTGATTTAGAGTTTGTAAGGATCAAGCTTGGCTCACCTATAAAATATATTCAGTCTTTAATC
CTACCGTCTAAGTCGTAGTCGGTTCCCTTAGACCGGGAACCGTGAACTTGTTGTTCACCGAGAGCTTACGCTCTCTAGCACTTCATCTGTGCAAGGTGCT
GTGTGCCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCTACGCGGGTAGGATTGGACTACCTGAATCCTCTGTGGTCTCAAAGCCTGAGCCACT
ATGTAACGAAGTGAGTTTCCTCACTTGGACGACTCGCAGTTCGAGTCCGTTCGAAAGATGGGAGGCATCTTTGGGAGGGATGTCCTCCGAGGCTTGGCGT
CGGTGACGCCAGCCGAGCAAGTCGAACGCGTTCACGCGTTCGACACGTATGAGCGTGAGCTCATTGCTCACGTGCAGGGAAACCTGCAGACCTCTGTGGC
CAAGCCGAAGCCGGTCCAGCCGAAGCCTTTGCGGCTGGCTGTGCCTGCGTTCGAAGGGAAGGAAGGTGAAAACCTTCACTTCTGGATCCGAGAAGTTGAG
ATTGCCATGAGGGCGGGTCTCATCTCGGATCAGGGACTTCGCGTTGCGTTCGCGTTGTCCAACCTAAGCGGTCGTGCCAAGAATTGGGCATACACGCTGG
AGACGACGTCTCCTGGATGCTTTGCATCCTGGAACAGTTGTGCGAGCGGCTTCGCGCTGCGTTTCTCCCGGCGAACGATGCGTTCCGCCAGCGCTCACGC
TTCCTCACCTGTAAGCAAGGGAAGCGCGAGCTGTACGAGTACGTACAAGAGATGCGCACGTTGGCATCATCGTTGGTGGGGAACCCCCTGCCCGAAGACG
TCAAGACGACGGTCTTCATGGACGGCTTGAAGGTCGGTCCCGCACACACGCAGTTATTCCGCGTGCATGCATCCACTATGGAGGAGGCGATTAAGCTCGC
CCTCCAGGAGGAGTACAGCCATAAGCAGGCTGGTACTCCGGTTGTTGCGCAACTTGTCGTTGCGAACAACGAGCCAGAGCCTATGGACTTGAGCTCTGCT
GAGCTTGGCTCGGTCCGCTGCTATAAATGCGGCGGACTAGGACACTACCAACGTGTGTGTCCTTCGACTGGGGTGGGAAGAACCCATCCCTCAAACCCCG
AGGGCCTAACGGTCGCTGGCGCAAGCCGCG