Description :
From Genome Similarity Track
Location :
Scaffold_1175:4225- 8856
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1175-fgenesh-gene-0.0FGFR1 oncogene partner
Pytiw_DAOMBR242034maker-piw_contig_1175-fgenesh-gene-0.2Transmembrane protein 70

Sequence
4631 bases(100 bases per row)
GACGCCAAGGTCGTGCGCGCATTGTTGCGTGGCATGCTGCGCTTTGGCGACTTGACCGACGTGAACCTGTTTGCGTCCAGCCGCGAGGCCTTTGCAGATG
AGCACAAGCTGCCGAACTTTGTGCTGAGATCGAATCTCCCGGCATCCACGAAAGCCCCCGAGGACAAGTTGCTCAAGACGGCGTCCGAGATCGCTGAGCA
CGTGCAGAAGTCGCTGGAAGAGAAGCAGGACAGCATGAAGTATGCCGATGTTGAGGTGAAGCCGAGCCAGATCATCGAGCGGCTGTACGAGAACCTCAAG
CTGCGCGTCGCAGTGCAGCGTGCATTGCGAGACGCCCGGTATAAGAAGAACGACGACAAGGGTGCGTACGTGCTGGTTGCGAAGCAGTCGGACTTGCCGA
CGCTCGGGATCTCACGGGACGCGGTCCCGCCCTGGTCCTGGGCTGAGAAGGAACACGACTGGAATAGCAGGAAGGATACGGCGCTGCTCCTCGGTATTTA
TGTGCACGGCTTTGGCGCCTGGGAAGACATCCTGAACGACGATCTGCTGCATTTTAACTCGCAGCGGGCGCTCAAAGGCGAACGCATGAAGAAGCGCGCC
GAGAATCTGCTCAAGCGCCTGCCATCGCCCAACGAATCGGGCGACCCACGCGTCGTCCAGCTAGCCAACGCGCTGATCACTGGCGCGCAGAACCCAGGCC
AGTCGCTCGGTGCTCAGTTCAGTGCGATTATCAACAAAGACAGCAGTACCAACAACAACGGTGGCATCCCGAGCAAAGGGCGATTGCATCGTGCAGCTGA
ACGATTTGCTGCGCGCCAGACCACCGGCACCGGCGGCCCGGAGACGACAAGGGCCTCTACCCCAGATGACTCGATTCGACGCACGAATACACAGACCAGC
AGCAGCAGTAGCTCGTCGGATCGACATAGAAAACCGTCAGTCACGTCGCCAGCGATGACACCGACCCCAGCAGCAATAGCAACATCGTCGGCAGGATACA
GCGACCTGGATCCTGAGGATGGGGAAGTGGGAGGCGCCAAGCCTGCAGCCAGTGTGAAGCGGTCGTCATCGCCCAAGAAACGGCCATCGTTGTCTTCGTC
ATCGACGACGAAGCGGTCGGCGTCCATAGAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCGAGCACCGACTCGCCGCGGAAGAAGAGCAAGCGCAGCAGCGCAGACCAGTCGTCGCGCAAGGAAAAGAAGAAGCAGCAGCGCCGC
ATACTGTCGACAGAGGAGAGCTACGAGAAGTGGAAGCCGAGCAAGCGGCTGAAGAACATCCGGCAGGTGCTCAAGAAGATGAAGATCATGGCGGACTGGT
CCAAGAACCAGAAGGACGAGGTGGTCGTGGAGAAAGTGTTCAAGTACGTGACGACGATCGGCGAGGCGATTGACGCGATTGTGCAGCGCGTAGAGAAGAA
AGAGGACAAGCTCGACAGCCACGAGTGGGACGAGCTCTGCTCGAGCCTGTGGTCCTACGCTGCCGGGTTCACGCCCTTCTCGTCCGTGCTCTTCGAGCGG
CTCTACGACGACATTTGCGCTGACGGGGACTCGCTCCGACAAGGTTTAGACAAGGGACTCCGGCCGTCCACATGACACTGTGTGTGGGAGAAAGAGAAAG
TGGCGACAATGAACCAGTACAGAAAATGAAGCACACGACGCGCTGATGACAAACAAGAGACGACCGTCAAGGCGCGATGAAGAAATGCAGTGGGGTGACG
AAGCAAAGGGAGGCAAAACAAACAAGACACACACACTGCGGGTGGCTGGGGATGATGGAAATGATGACCGTATGTAATGTAGGCCGATGAATATATTCAC
ACACACCTACGCTATGAGACCCGTGTGCGTGAGTGAGTGTGAGTCCCTATTCTGAGGTTGCCTGTTACAGGCTCGACACACAGCTCAAAGGGTCACCGAG
AAGCACAAGCAGGGCTTGGCAATATGCCACCATCACCGCCCACAGATGAAGAGCTGGAGCTCAAGCAGCACGTGACCAAGACGCTGACGAGCCAGGGGGT
GCTGGGCAAGATCAAGGTACGTGTGACAACGTTGGTGAAATTGCTGTGAGTAGTAGTATGAGGCTAACAAATCTGTGAATCCCTTTGCTCAGGCGCAGCT
TCGAGCGGCCGTGTTCCATGTGATGCACGAGCACGAGATGCAGACCGAGGACCCGCTGGTCGCGACGCGCAACAAGTTGCAATTGTTCAAAGAGGACGGC
GACCTGGCGCTGGCGGTCGTGCTCGACTTCCTCACGTTCTTTGAGCTCGACCACTCGCTTGCGGTGCTCAAAGCCGAGGCGAATAGCAGTCAGGAGGACT
ACGAGCAGCTGACAAAGCTGCGGGAGCGACTGGGACTAGTGAGCGACAACAACGGAGAAGTTGGTGGATCGACTCAGCAGACCCCACTGCTGATCCAAAT
GCTAAAGCAGCAGTCTCAAGTGCAGCTAGCGAGCAAGGAGATCATGGACACTGGTGGTGCTGCTGCCTTCGCGAGCCATGACCAGAGGCTGGCTGAGGAT
ATCTCTGATGCCAAGGACGGGTTCATGCGCTGGAAGCTCAACAGTGAACGGCCGCTATCCAGCACCAACACCAGTGTCAGTACAAAGCCTGTGAGCAATC
GAGCTGGTGACGCAGTGAAGATCGATGATGATGATGCTGAAGACGAAGACGCAGCAGTCAAGATATTTGAGAAGGCGAAAGAGAAGGCAGAGTCCGAGAG
CGAAGACGAAGAAATCGTCAGTGGCTCGGAGTTGAGCGAGTCGATCGCAGAAGAGCAGCAGTCTACGAGCCCCAACTACAGCCAGGACTACGACGAGTCT
GCGAGCAAGGACTTTGAAGGGGACAGAGTGACCAGAGGCGCTGCTGCCCAAGCTCAAGCAGCGAGCGTTCGAGCTCCTGCGATTCAGGAAAATGAGGATG
AAGGCGATGCTCATGGAGACAGTGGCGATGAGACCGCCACCAATTACCAGCCTGCTGGTGCTGTCAACACTGATCGAGACGGGCACGAGAGTGACGATGG
TGACGACGCGACTGGCCCTCCACCAGTGCCAACGAAGCTGGTGGCCCTGCCACAGGCTCCCTTACCAAACAGTGCCAACAGAGAGCCACCTCAGGACGAC
GACGAGTTTGACGAGGTAAGAAAGAGCTCATGGTATCCACTTGCGTGTCTTGTCTGTGTTAACTAGCTGAACCAATTTCCATCTCTTCTGAATATGACAA
TAAATGTTGTAGGAGCTTGAAGCTGCGCGCCTGAGCTCGCTGGACGCCAAGCTCAAGGCCATGGAGGCCGAGGACGAGACCGGCACGCTGCAGCAGCTCA
AGGCGACGCTGCAGATGGAACTGCAGCACGACGACGACGCCAAGAGCCGCAAATCAGCCGCCACTGACAAGGACAACGACGACCACGACGGCTACGGCAG
CGACTTTGAAGAGGAGGAAGTCATCAGTGAGATCTCGGACGACGAGGTCGGCTCCGGCTCAGACCTGCTCTCGGAGAACGACGAGTCCCAAATGCTCTCT
ACGCTCCAGGCGCGAGCAGCTCCAGCAGAAGCCCCTTTGCCTTCCGAGGACCGGGCCGTTGCGGACGAGAACGCGCTTAACAGCTACGACTACATTGAAC
AAGTCGAGCGAGACTGGTAGACGTTTATCATGGCACACTCTCTCGATACAAACCAATACGAGTCTCTATTTTGTTCGTCTCTCTCTCTCTCTTAGGCTGT
GTAGGAAAATGACCTAAGGATTCAGGACGAGGTCGCGCTTATTCGTCGTCTTCGTCGTCCTCGTCCTTTCGCGGGGCCGTGATCTTCTTGCCGATAAGCT
TTTCGGCAAAGTCGCGGTCCTCAAAGACCTCGGGGTGGACGAAGAAGCTCTTGCCCTTGGCCTGGAACGAGAGCATCGGGTGCATGCCTGACGGTGGCGG
CGACACGTCCGAGAGCTTGAAGTGGCGCTTGGTGAGCTGCGCGAAGAGCGTGACGGTCTCGACCGTGAGCTCCGGGTCGGTCACGGACTGCGTGCTCTCG
CCGTTCGTGAGCCACATGCGCATCACGTACGGCTTGAAGAGCACATGGAAGAGCGACGTCGTGCCCAGTCCAAAGAGCTGTGCATATAGAGAGGTGCAGA
GTTAGTTCTATGGCCAGGAAGCGTGTCGATATGGCCCAAGCATGTCCTCATTAAACAGTGATCGTACCATGATGGTGCCGCACATCGCCCACTGTAGTAT
CAGCAGCAATAGACACGGTCATGAGATAATAAATTAGCATCCACAAGCAGCCAGACATACGCGCCACAGTATTGACATCCAATAAATAAGCACACACACC
TTGCCGACTATGGAGGCCGACTGCTCGCTGACGAGGCAGAGCGTGGGCATGCCGACGGACGTGAGGATGCACGACGTGACCGACACGCCCTTCATGAGGC
GTACGGCGCGCGACATGGGTCCTTCGTACAC