Description :
From Genome Similarity Track
Location :
Scaffold_261:42245- 44904
Transcript NameFunction/comments
Hyaar_Emoy2813303hypothetical protein
Hyaar_Emoy2813304RND efflux transporter

Sequence
2659 bases(100 bases per row)
ATGATGGATTCAATGCCAGCCGGAGGACGTCACCAGCCCTTAAGTGCGCAAGTGTACAAACCACACATTCAGCCAGCAACTTTTGATCTCTCATCAGCTC
CACCTCTACATTCTAGTTGCCTATATATTGCTCGCAAAAATCGGTCGAAATGATCTTCGACGTGTCGTTGTGATGGTAATATCGAATTTAAGTATCCTTG
TCTATAGTGCTCGAGTGCCATAGGCGACATCAAATGATGTCCTGAAGGAGTGTTTACACTGCTTTTACGTTAGCGAGCCCTTGCGAAATTGCAAGGTAGA
GACCGGATTTAGCGGCTTTGGTGATCTTAGACGCTGGTATAACAACAATGTGTTCCGTGTCATTACTGTACGAGTGACATGCAGCTTAACTCGTTGTCTC
GAGCTTCTTGTCGAATCAAAGTGGCTCGTCACTGAGTTGAACCCCAATTTACCAACAATTCCACCCACAGTCAAGGCGAAAACCCACGCGTGATCAAAGA
CCCAAGACACGCGGGACAAAACAATCAATACCTGCGAGACCTGAATTCGAGTCGAATTCCAATCCACTCGGCCCCCCTACTTTATAGAAACGCCATCCAC
TGGTCTGTTCGACATAAGGCTCAAGCATTTCTAATCGTGGTTAGTATTGTGTAATTGTGCTATAGTTTAGTATACGCGCTATACGCATACACCCGACACG
TCCCTGCTCCAATACGAAATTCTTATTTTTTCCTTTTCAAAATTCTGATTTTCAGAGTGTATCCACCGTCCCCTAACTGAACAGCCGCATACAATATCCA
AGTCTTTTCACCCTCATGGCCACCCACGACGTCACGTACGTCGAGCTCCACGACGCGTCGTCGCGAGCGACTATCGCGCTATACGCAGGTATACCGAAGC
TCGAGCTTCAGTTGCTCGTGTCTGCCGCGCTCAATCACTACGACCGCGCGTGTACGGGCTTCCACCTCCCCGCCAAAGCTTCGTCGAGCAGACGACCGGA
ACGTTCGCCGCACGTGCTTTCGCGCCTTGTCCCACTGTCGGTCGCGTGTCGCGCACCGGAACAACTGGTCGGCCCTGTCTCAGCTCTGTTTGCGCCAGTC
CCAGCTGTTTCCCGAGCATTTGCAACGCCGGACACGACATGGCTACATTCAGAAAAAAGCGACGAAACCGATATTAAGGTGGACCACATGGGTACAAAAG
CAGCTGCAATAGCGACTCAAGTCGGGAGTAACAGCAACACGCTAGCAGCCAAGCAAATGGCTACATCACAGCCAAATTCAAGTACCAAGTGGACAAAAGA
GCATGCAATGACACCCGATCGTGCTTTTATAGGAGTACATAATGAAGAAGACGCTGAAGATCAGCCGCAGTCGTTGTTCAAGTCAACGGTTCAGGCTNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCCGCAGT
CGTTGTTCAAGTCAACGGTTCAGGCTTTGCATACGCTTCACATGCTGACGAGCTTGGAGCTTGATATTATTGAAGCTTTGTTGGACCAGGACGATTCGCA
GGTGCTGCAGGTGCTGCGTGTTTACGAACAGAGTGATGATCGGGATGTAACTGCGTTGAGAGATGCGCTCGTGGGTATCGTCGAAGATATTACGATGGAA
CTTGGTGATGAAGAAAAAGCAGCGGCGGCTTTTGCGCGTGGTCTAGGCGACGCTGGTCGAGAAGAGAGTGAATGGGCTGACAGCGAAGATAACAACGACG
ACTCGCTTGGTTGGCAGCACCATTTGTACTTTCTGCTTCGCCAATGGCAAGTTGAGCAACACCTTACACTGGCTGATGTGTCGACGCTGCAAAACATGGT
CAACCAACGACATAGTTTGTTGGAAAGCGCGTACGAAGTGTTTGCAGGTGACGGGGATGCTAGTGAGCTGTTGGATACACTGCAACGGGTGGCTAAACTT
CAGCGGCTGATTGAGCAAAGTCAGGCTGGGCAGAACGGTGTGGCTGGTGCACCTGTGAGCAGTCTGAGCCTTGAAGATGTCGTACAAGAGATGCAACGTC
GTGGTACGGTGAAGAGTGGTGATGCTGCTGGACTGTTGGTGTTGTTTCACGGTGGTAATGAAGCGCTTCGAGCTGCTAATGAGGCGTTCCAAGCAGATGG
CGATGTTCATGAGTTGGAGGACACTTTGTTATTGGTGGTGAAGCATGCACGCTTTGGATGCGAGGAAGAAGAGACTAGTACGGCTACTGAAGTCCAAGCT
GCGTGCCGGCTTTTGGCAGATCTTGGAAGGAGTGGACTTCTTGAATTGTGGCAGATCCAGTTGTCGATGTCGTTATTGAAGTGTCGTGACCCGCGTTTTT
TTGCAGCCATTGACGTGTACCATGAGGATCAGGACACGAATGAACTCGTAGACACACTT