Description :
From Genome Similarity Track
Location :
Scaffold_905:4223- 6541
Transcript NameFunction/comments
Phyag_g8639myosin-like protein

Sequence
2318 bases(100 bases per row)
gaacTTGCGCGtacgcagctcctcgagcgcTTCGAGGGCGCCTTGGCGGAAGAACACGCGCGTCTTGCCGACCTGGTACTCGCTATCCTTGGCCGGCATC
AgttgctcaagcagctcgcgaACAGCGGCAGCCGTCTTGGCTTCATCCGCAGGGTTCTCATCGGCAGTCGCAGTGAGAACAGCAAGCGCAGAGGGCTTGC
CGTCCACAGTGGCGGTCGAGGCCACACCACGGAAACGCTCGAGGAAcatcgtctgcagcacacgGTTGGGGTAAGCCATACGACTAATACGGACGGCCTC
CACCACACCGgcgcactgcagctgctccgtCACACGCAGCTTGTTGAAGATAAGCGggctcttcttgctgttggGCTTGATGCAACGAATGTAGTGCACG
TTCGTGCGGCGAATGTCCTCCATGAGGCCATTCAGCTGGCTCTTAAACTGCGTGCCCACCGTGTCGGCAACAATCgagttcttgcgcttcaggACGCCCC
GGCCACGCGAAGCGTTAGCCGCAGACGCAGCGCTCGTACCAGGGATACCGGTCATCGCATCACCCACGTGCTCGTCGGggaacagcttcttcaggaaCGG
TGCCTTCGACTTCTTAATCAGCAGGATTAGGTCATTCTGCAGAGCGTCCGTgttcttgagcaggaagCCAGTCGTGTCGTACTGCACAGGTCCAGCGTAG
TGCTTGATCACGAAAGCGTCGCGAGCGAAACGCGGGCACTCAAAACGATCGTTGTCGCTGTAATGcgccttcaacttgttgGCGAACGCAGCATCGCTAC
CCTTGGGACGCATGCACTCTTCGTTCAGCAGTGACAACACACCGAAACGACCCTCGAGCAGCGACAGGACGTTGACGTTATCCGCGAACTCGATACGCGT
CCACGGGATGCCCTCGTCCTCATACTCCTGCTGGATGGACTTGAACACATCCTGCGTaaacttctgctgcagcttttcgtTGGCGTAGTTGATGCACAAT
TGTTCGAATGAGTTCTTCTCGAAGATCTCGAAACCGAAGATATCCAGGATGCAAATCTTGTGAGCCACATCCGCGTGAGGGGCGCTCGTCGACATGTTCA
CACGGTGAATCAGCCACGAGAACATGTGCGAGTACAGCGCCACGCCCAGAGCCGTACGCGCTCCCTCCGCCTGCGAGACGTTCAGCGGCACCTCGTACGT
CTCCATGACAGCCGTCATCTCGCGCGTGCACAATGCCGAATGCAACTGATTGTCATCGAACTCCAGGAGCTGCGACACCAACTCGCTTGCATGCTGGTTC
TCCGGCGTGCCCGTAAGCTGCGACGCGTCATCGTTGTCTGCCGTGGGCTCGAACTGTAGTCGCGACAAGTGCAGAATAGCTGCCACAACCTTGAAAATGC
TCATCTGGTCCTCCTTGGACACGCCCATGGTCTCCAGACATGAGACTGTCTGCTGGAATCGCTCGGCATCCTTCAACCCAGCACTGACGTCAATACCCTT
GGTCAGATCTTCGTCGTGGGGCTTGATAAACGGGAAGTCCTTGGCTTGCATGCCCGTGACCTTCACCTCCGTCGTCACATCTTCCGGTGCAGCCAGCAAC
TGGTAGAAAATGTGGTAGTTGCGCTCCCCCAGCCCTTGCATCGACACACGcgacttctccagcagatacGTGCGAGATCGAGCTCCGATCAATTGGCCCA
AGTTgtcgaactgcagctccgagaaTTTACCGAATCGACTTGAGTTGTCATTGCGCGACGTCTTGGCGTTACCGAACGACTCCATGAGCGGGTTAGCATC
TAAAACCCTCTCAATGATGCTAGCCTCTTTAGCCTGAGCGTCCGTGGTTGAGTGGCTGCCGGCCGACGCCAAGTGGGACATCAAAATCTTGGTCGTCTCC
GTCTTACCAGCTCCAGACTCGCCACTGACCAAGATACTCTGGTCTTCACCGAAGACGCGCATGTGCTGGAAAGCTCCGGCACTGGTGGCGTAGACGTGAG
GAGGCAGTTCACTGCGGTCGCGCTCCATATACtgatcctgcagctctttcGTGTAGATATCGAGCCATGAGTACTATAAAAAAGCACATTTTTCAGAAAA
GAAAAAGCACAAGTTTAGTAACAACTCAGGTTTTGTTGCGCAAAAGTGGGAGAATGGATAAAACGTACGGGATTGACGGCGATGCAAATGGCGCCAGTGT
ATGTGTAAGGGATTTGTCGCAAGAAGCGGTGCTTGAGGTTGAACAGGATGGCGGGCTCGTGCAGGTAGTTGAGACTCACCATATCGGCGCAGCCGTCCTC
GGCCCCGAGCgcgttttg