Description :
From Genome Similarity Track
Location :
Scaffold_925:422- 6544
Transcript NameFunction/comments
Phymu_g12364hypothetical protein

Sequence
6122 bases(100 bases per row)
TGGCTTGAAGTCGATACACTCGCCGACATCTTTGTGCACTCCGATACAAACCTCTCCAATGGAAATGACCTCGGATCCGTTGGTTGGTGCGGCCGATTCC
TGGGTGGCCTCCTTCCAAGGTTGTGTGATAGTGATGTAGAATATCTTTCTGCAGCGTTTCCGGAACGACTAGTCTCATCAATTCTTCGCAATCGTCGTTC
GATCTCGTCGCGGGAGGGCAATAGAAGCGCAGAtcgtgctcgtccacctcatAATCTGCCGCGATCTTGCCATAAGACCGAGATTCGGCTTGGGTAAGAT
TCGTAATCTGCCCGATCGGATATTTCTTCATCCCTGTGATCCaggcttcttcgtcttgatcCCGCTTAATCCGGTCGTTCCGCCTATCTCTGATCAACGC
TTCCCACGGCTTCAAAACCTCTACGAGGATTGGCTCACGTAGCAACGGCCGATATCCGCACCACTGGATCACTGGACTTGGGCACTAGGACCTCGTCCAA
CCGGTTCAGGGTGACTAGATCTGGGTGATCAGCGTCGCCCCGGATCTCGATTCTGCTTTGCCGCTGCAAGGCTGCGCTCGCCAGACTGTTAGCGCTCTCA
TTCCAATCTCTCTTCACATGTACTAGTTCGTCATCGCCCCACTTCCTCAGGTGATCGAGGACCCTCAGTTTCAATAAAGTCAGTTGCGGTGCCTTACAGT
CGATCTCGCCGCGAATCTGCCTGGTCACAACGGTACAATCGCCGCAGATCACCAGGCGCCGATTATCGAGATCCTTTTGTAGTTCGAGTCCCAGCAACAG
ACCGTTATTTTCGGCTTCGTTGACACTGAggctctctctctctccatACCCTGACCTGGCCTTGATCACCTTCCATTCGGGCAGCCTCCACCCGATTGCG
CTAAAagcacctccacctcgcttcACCCGAGCTGATCCATCAAACCTTATAACCCACAATTCTTCATCTCGATCCACAGTGGGGGTTGGTACATGGATCC
GGCGTTTAGGCTCCTTCCGAGGTGCGATCGCGATCAACGCTTCGTCGATCTCAGATCTCGGCATGATGCTGGCAGCGATCGCACCCAGTATTTCGTCCTC
TCCCTTTGTACACTTCGTGATCTCGAGTGTTCATGGCGACAGAAGTGCCGACTGTTGCCCTAGGCGACCTTGGCGCCCCGCTGACTTGAATAACCAGGCA
AACGTGGAATGGCTGGTGAGGACCTTGATCTCGCGTCCCACGAGCAGATTATAGTAGAGATCTAGGATCCGCAGCAGTGCCAACACCCCTTTTTCCGCCA
CATTGTAATCCAGCTCGTTTACCTCCAACGTAGGACTAGCGAGAGCTACAGGTTGATGTATTCCGTCGTGTTCTTGCATCAGTGTGGCTGAGATCGACCA
GTCGCTAGCATACGTAATCACCACCGATCGTCTCGTCACGTCGAAGTGACGCTGGATTGACGTAGTTACGATCTTTATCTTAAAAGCCGTGAGCCCCTTG
TGGGCTCTGATCCACTTTTCGTCCTCATCTCCGATCTGCTTTCCGCTCCGTCTGATCCGAGATCGCGCGCCCCCGAGTCTAGATGCGCTATACGATCGAT
CTCCCGGTTATATCTTCCGGGTGATCTCGTGGAGTTAGATTCTGGTGAGGTGTGATCGCGCGAGATCAGGTCCGTTCGGTCCATGATATTCCGAAGATCG
GGTTGTTTCTTCAGCTCTGCGAATTCCACTTCAAGTAATTTATATAGAACTGAGGCATAGACCGCGTAGCCTTCGATGAATCAGATGTAGTAGTTCAAAC
TACCCAAGAACGACTGCATGGATCGAAGTGATCCGGGAAATGACAGATCAGCCAGAGATCATTTGGGTTCGCCTCCAGACACTTGATCGACACCCGGTGT
CCAAGATATTCCACCTTGCTCATGCCCCAGAACCTCTTTGCCACGCTGATCGGCAACTTCCACTTGTCGCAGGCTTCCAGTAGATCTTCCGCCCTTTGGT
ACATCTGATCCAACAATCCAGCGGTGATcatgctgtcgtcgtcctaTGATCTACGTCCCAACACCGATGGTTAGCCTGGACCTTCCGGTATCCCTGACTC
AAACACGTCGGCTAAGCCTTCTGAGTCACCAGATCGTGAAATTTTCAGGAATCCGTGCAAGACGTTGTCTACAAGGCGTTGGTATATCTGTGGGGCATTC
TTCAGTCCGAAGGGCATACAATTCCATTTGAACAGACCGGACGGAGTGATGAACGCCGGGATCGCGCGTGCCGGGTCCGTCATCGCCACAACCCCGAATC
TGCTTGCCATATCAAGTGAGAAGTACCAAAGAACCTTGTcaagatcttccagcagatcGTTGATCAGGAGCATTGGTTAGTTCATCAGCCTAGTAAGGCC
GGTCACTACTCTGTAATCGATGCATAACCGGATATCCACAacattcttcttgatgatTACCACGATCGGGACGCCCATGGGGATGTCGAAGGCCGGCTGA
TCTAGGCTATTAGGAGACCCTTGATCAGGTCTGACACTTTCTCACGGAATTGAGGTGCCACCTTACGCACTCGTTGCGCGATCGGTGTCGCATTCCCGAC
AATATCGCATATAACTTCTCTGGCGGCCGGCGGTAGTGCATTTCCTTTGCCGATCAAGAGATATCGTTTCTTCCAGATGATCTGCCGGAGTTTTTCGATC
TCCTGTGGCGTGGCGGATTCTGGATCACCTACCTGTAGATCTTCGATCTTGACCTCTTCAGTAGTTGAGATCGAGATTTCCGAGACTACGGCGAGGTTAT
CTGCGAGGTCCTCGGCTGAGAGATCGCCACTTTCGTGATAATGGACTTGATCGTCGTTTTTGATCTCCTGGGAGGGGGTCGATTCTGGATCTCTTCCTGG
TGGATATTcctgcttggcctcttcCTTCACTTGGATAACAGTCTGCGTGGTTGCTGCGGTGTCGTCAGCGCGAGATACAGGCGTGATTCGGGTTCGAGAG
CCTGGATCGCTCTTTTTCGTCTCGATTTTCTTCGTTATTTCGATTCGGGGGCTTATCTGGCGTGCTCTCACATATCCCTCCGCCCCCAGCATCGCCACTG
AAGGTCCCACCTGGATCGACTTCGGGTTCCGTCTTAGATGTGTTATCTCCATCCGGACTGAGGAACGCGACTTGGATCTCGCTCATGTCAGTCTACTGTA
CCAGTGATCGATCCTCTAGGCTCGACATCAAGGGGTTTCTgcggtcgatctcgtcggtTTTGCGCCGGTGAAGTATCGACCTCGGTGTAGTATATGCCGG
ACGTTCTACAAGTGGCTCCACGGTCCCTTTCGGGGTATTGGGGGCTCTGATCAAGCTTCCACCGTGGCTTCCAGTGCTAGATTCTGCCACTCCATGTAGC
GGCGAGACCCCACGAACACGAAACCAGGCGATCTGGGTACTTTTTTCTCGATCTATTACCATTCTGACGTTGAGTCGATGATCCAACAACCACAAGATCT
TCTCGCCAAGATTTGTGATCACGAGATACCGAGTCCGCCCTATGCCGTTCACCACCGTTGGAACCCACTGTTCCGCTCTGGCCACCCAGAGTTTCTCCGT
AGCCGACAATTTCACTCAGCGTCTGTCTCAGTTGATTCCCCAACCGGGACCTAAATATCTTCCTCGAGTGTGATCGATCTCACCTTATCCCCGTACAGTC
TTTTATGACCATTAAGTGGAGTACCGATCTCGTCGGGTAGGCATATCGATTCTTTGGCGAGATCCATCCGGACCCCTGCTGGGATCATAGAATCCACACC
CAGGATCGCATCCTGACCAGAGAGATCGCCAATCCAGATGTCGAAAGTGTATACCAGATATCCTGCCAGCGTGATCTTGATCCTAGTTTCCCTTCAGTGG
TGTACACGTTATCGCCAATTCCCACACATTCCTGTCACTGACTAGTGACAAAATGGCACCCAACCTTACGAGCAAAGGTAGTATCCAATTCAGATACTTC
GGCGCCATTGTCCAGGAGCAAGATCGCTTTCTCATGATTGATCTTGCCTGAAATCTTGGCTTGTCGGAACCACTTCCCTGGGGCATGATACTTCCAGTAA
CCCCAGGACTCTCCTTCTTTGAGATCCAAGGCAACTTCGGCACCAGATCGGCGGAACTCATCGGTTCGAGGAAGGTTTACGATCTCTGCGGCATATGGAT
GCAATTCACATGTATTACCACGTAGATCAGACTCTTCCCTACCTCGATCTACCGACTTCTTGTTCACGTATGCGTAGATGCAGTATCTAGAACGCTCAGC
ACGTACCGGATTCCAACCTGGCGAGTGTCCTAGTTTAACCTCTTTTCCACCTCCTCAGGGAACATCCCTGCATGTCGCGTCGGATCATACCACTTGCGAA
TCTGGTTGTAGAACTCTTCCATGAGGcattctccagcttcgtgGACCTTCCTACACCCACGACACACGTATAAGGGGCGATCCGTTGGGTGGTATCGCTT
TCCACACTTCACGCAGGTCAAACGCTTCCAGCGATCGAGATCGGTATGCTTCCTGGATCCACAGTGCAAACAACGACCGCGATCCGGGGGAGTCCGGCGA
TCGGGGTTCCGGGCTCGATCTTGCATGTTCGGGTGAGATCGTGTGAGATCCGGTTGGTGGGGCCCGCCCCCAGCACCGATTGGCTgatcttcagctgcag
caaggTAGTTCCGCCGCAGATCACCTTCGGATCCGTATGATCCGGACGCTCCCTCTGACTCCGAACTCAGCTCTTGAGCCCGGATCGCGCGAACCACTGC
TCTAGCGGGTGCTGCAGGCGTGTTCGACGGGGTATTTTGCAGGTACTTCGATCCAACCGCAGAACGTCTGCTCTTTGCCCGTTCTCGTGCTCGGAGAATC
TCTTTGAAGTCGTCGACATCACTCAACCAGAGCAAGGTCAGGCGATCAGCCAGCTCCGGACCACCTAAAGTCTCGATGAAGTGGTCGGCGTGTTCCCGGT
GGGCCTTAGGATTTCCATccttgctcttgagcttAGCTCGCAAGGCGGCCACGTTCAGACGGTACAGATAATCGAGAGGAGTTTCTTCAGATCGCTTGCG
CGCGTGGCAGAATTGTCACGCCACTGGCATTCCTAGACCACACTAATGGGTCTGAAAACTgtccagcagatccgccCACTTGGTTTTGGTCGTTCGACTC
AACTGTCGATACCAGTTCTCCGCCGGGCCGATCATGAGGTCTGCAAAAGTGAGACATTTTTCCTCTTCAGTGGGCTGGTCTCGCAGGAACGCGGACTTGA
CTTTGCAGATCCAGGGTCGGGCACAATCTTCATCGAGATCCTTGCCGGCGAACTCATTCAGATCCGAGATCGCTGAGATCCGGACTCTCTTGATCATCAA
TGATCCTCCTTGCCCGATCGCGGCTGAGGCCACGGCTGCCTGgctcgtagtcgtcgtcgcgGGGCCCGCGATCTCCAAATCGTCCGGGTCATATTCCCAT
GAGTGTGGAACTGGGGTAATTACTGACTCCATATCAACATCTTTCGCCTCCGCGTACTTCGGGAGGTTGACTGATCTAGGAGCAGCCAGAATTTCCTCCT
TCAGGGACCGATTCATCGCCACCTGAAAGTATTCGTCCAACTTGCAACTGAATCCTGTCGAATTGGTTGTCACCGTGGCTGGATCCACCGCGGCCTGGCG
GTCTTCTCGCCGGTCCGGTGTTTTAACGGCTGTCTTCAGCCCAGCCGATCGTAGAtcttgcttcttcatgcgtGATCTCAAGAGCTTGGCCCCACAGGGC
CCAGCGGCATTCTTTGCGGCCATCGGGACCTATCCGAGTCAGACTCTCAGGTGGCTGACGCGTAATGGGAAGGTTCGGTCTTATATCCGGGATCCAGCGT
CTCCGAACGCCCACCTACCAAGATCTTCAGGAGATCGAAAAGGCTTCGGGTCGCTGATTGGATGACGCCGAGATCCATGTCGAACAAGGAGTTCGGATTG
AACTATCCAGCTACCAGACCGACctcttgcagcagctccagcaaaatGTTCACCGCACTCAGCCGATTCGGGGGGTTGACACTGGTCCTGCCAGATCTCC
GATCTGTCGAAACGGTATGATC