Description :
From Genome Similarity Track
Location :
Scaffold_192:422- 6249
Transcript NameFunction/comments
Phyag_g3293hypothetical protein PHYSODRAFT_249765

Sequence
5827 bases(100 bases per row)
TGTAACCGTACAGTAACCTTACTGCAACTCGTGCAGCCTCCTGGCGCAGGTCTTGGAGACCAAGCATTTCATTACATTCAAATTTAGTATGGCACGTTAC
GTCGGCCGACCGTTCTCAAGACTGCATTCGCCAAGGCGTTGCCAGCACTCTATCACTCGGCAAAATGCCATCAAGACTCCCAGTCAGCATCTGGCGCAAG
CAGGAGGTCCTCCTGTGGATCAAGAAGGAAGGCGGTCAAGTTCCCACGCGAGCGATTAAATAATTCCGCGAGAAAGGGTGGAAGCTGGGCGGTGGAAGTG
tgtgacggtggtggtgtgatcgtgagaagctgctcgctgcGGACCCATCTAGCCGAAGGCTTCCAGGAGGCGGCCGACCTCCCCTGTCCGGCGGTATGGA
GGAGGCTCTGTACGACGAGATTGTGGCGAAGAGGCTGAAGAAAGAGAAAGtcacgcgcgcgtggattGGCCACATGGCCAGGGTGATTTTCGCTTGCCAG
AATGCCGATAGTGTGGGCCCTGGCGGCTTTGTTGCCTCCCCTCATTGGATCACAGGGTTCATGCGCCGATATGGATTGTCGCTGCGTCGACGTACCAACC
TGACCACCCTCACCGATGACGCTCTTGTGGATCGAGCGGTGTCTTACATGGCGTTCCTGCAAAACGCGAAGCCTGCCATGGACTTGAATCGCACAATTCT
GATGGATGAGACGGCCGTTTACTTCGAAGATGCGCGTAATCAGACAGTGGACCTAATCGACAATCGTCACGTTGTGGTGCGGTCTACGGGGTTTTCGTCG
ATGCGAATTACGGCGGTGCTCGCCGTGTCTGCAGCAGGCAAAAAGCTTTCTCCACTTTTGATATGGAAGGGTAAGGCTTCCCCCTCTTTTGACAAGATCA
GAGGAGTGTATGTGGCTCATCAGCCCCGAGCATGGGTTGACAGCATGCTCTTAAAGCGCTGGATCGACCTTGCCTTTTTGCTGGTCGACGTGGGTGAGGG
GAAGCATCTGGTCTGGGATTCGATGCGCGCTCACATCTCTAAAGAGGTCAAGGCGAAATGCGCTGCCCGTGATGTTAGCATGTGCGTCATTCCTGGTGAA
TTCACGCCTTATCTTCAGGCGGGCAACATTGGTATCTACAAGGCGTTCAAGGACCTACTGTACATGGAGATTAACGCATGGAAGGAGAGCGACAATGTTG
AGTACACGCGATTTGGGAACCCCCGCATGCCGCCAGTGAATGTGGTCTGTGATTGGATTAGCAAGGCGTGGCACGATACGAACAGTAATACCGTGATTAA
CTCGATCACGGCTGCTGGTTTCGCAGAGGATTGCAAGGATTGGCATGTTGCGAGACACGACGTGTATGGAGAGCGGTTTTTGGCGAAGTGGGACGCTGGA
CAGGAAACCCAACTGGATGANCGCTGAGGTACAGGCAAAAAGGTAAGAGCAGCTTGGTAACCTTCTGCTAATAAACGTAACCTTTTGTGATCTGGTGAGG
GTACTATCAAATAGTGCCCGGGGTATTATTTGGGAATTTCTATTAGAATTGGAACGGACCAATCACAGATGACCTTACCGTTCTCCACAGAAATACGTTT
CTTTCTCGAAATTTCAGAGCTTCCTGAGGCCAAAGGCACGGTGCCAGCGTGCACCGAGGCGACTTCATGTCCATTTAGAACGTGGAAGTGTGGGTCAATC
TCAACAGCACCGATCTTCTTGAAAGCGGCGTGCCCAAATGTGACGATAAACTCTGCAACGCCGAAGTGGAGGATTCGTGCAAGAGCGAGGAACAACCTTT
ATTTCGGTGGGGTATGGTGGTTTTTTTCAGTCGCGTCTCTTCGTGTCCAACTTGACAAGATGCGGCGTTCCGTTCTGTGCCTGGTCTtactgctgcttgc
aggATATCACTCTACTGTATATGCCGTCGATGCCACGGTATCTGCTTCCTGGGGCAACGCGACGGTGCTGGCTGCGACGACCCTCGAGGTCCAGCTCACT
ACAGGAGATAACCCTCAGATTCCAGCGGACGCACTGCTGTCGATCCAACTGAATTCGCTCTTTACAGTCGCCCCAAACGCTACGGTGGATGATGCGGTGC
TACAAGAGACACTAGATGGCAACTGGAGCGTCTCTATAGACACGACTGCCACTACATTGGCGGTGCAGCGTGATTCTGGAACCATAGTGGGTTCAGGCAC
TCTGTTACGCTTCAAGTTGACAGGCATCACAAATCCTAGCCGTGCTGGTTGGAGAAACGTTGGATCATTTAATATTTCGGATCAGGGGACTTCGATTATC
CCAACGTTGCAGTTACCAGCGATGGAGGTCGAGCCTGGAGCGATTTGGAACGCACAGCTGGAGTTTTCGAACTTGCTTAGCGGGCGCAACACTTCGTTAG
AGATTCAAATGACGCTGGCACATGTTGTGCCTAACGATGGAGTTATTGCTGTGTATATGCCGTGTATGTATGGGTCATTGCCGAATGTAACCTTGTCAAG
TGTTGTTGGACTGGACGGTACTTTTACGATATCGACGAAGAATAATGTGATTTGGATTAAACGCGATGCTGCTTCGGGGACGGACAGtgtggagatgcag
aacgtGGTTATAGAGCTCGATGGAATTATTCACCCGTCGCTGGAGGGCCCTATGGGTCCTACCGTGTTGCTTCAGACACTGGATGACGTTAGCCTCGTCA
TTGACCAGACCTATGTGGACACGTCAGGGAATTTGCTCTCTCCATGCACGTGCCCTTATGGGTATACTTGCACGACCTCGAGCGACCCTGTGGCGTGTAC
GCTTGGCCAGACGAACAATGCGGACCATTCAGCCTGCGTTCCATGTCCGAAAGGCTACCAGTGCTCGCCGCTAAGCAATGCTTCCATGGCGTGTACAGCT
GGAAGTTACAGTCTGGATGGCGATGGTGAGTGCACGCAATGTCCGAAGGGTTTCATGTGTGCTACCACAACGGATGTCCCTGTTCAATGTGCTAGTGGAA
CGTACTCCCCTACTACTGGCTCAGTCGAGTGTTTGGCATGTGGTGTGGGATATTACAGCACTGTAGGTTCAATATCGTGCACAGCCTGCCTTCGCGGGCA
CGCATGCAATAGCTCTACAACTTCGGAGCCTGTTGCATGCACACCGGGTGCGTACAGTAGTGTCGAAGGAGCGATGGCGTGCAGTACATGTCCCGCTGGC
CATAGCTGTGTTGATGTCACCCAGTCACCACTTCTTTGCCAAATCGGCAGCTACAGCTTGGAGGTATGGTATATGGATGTAGTGTTTCTGTTGAGATATC
GCACTAATTGCTTGTGATTTCGTTTGGGTCAGGGTGATTACCTGTGCCACGCGTGTCCTGCAGGTAGTTATTGCCCCGACCAGTACAATGCTCCTCTGAG
TTGTGGTGCCGGTACATATTCGCTTGGCAGTGCCGCCGTGTGTACGCTGTGTGGGGTTGGCGTGAATTGTTCGGTGGACGCAGCTCCGGTATCCTGCGCG
GCGGGGTACTACTCGATCAATGCGTCAACTCCGTGCCAACTATGCAATGCAGGAAGCTATTGTCCGTCTACATCCCTGCCACCAGCGGCATGTGTCCAAG
GTACCTATAGCCATAGCGGAGCTGTGGCATGCACAGCCTGCCCTTTTGGGTATACTTGCACGACCTCGAGCGACCCTGTGGCGTGTACGCTTGGCCAGAC
GAACAATGCGGACCATTCAGCCTGCGTTCCATGTCCGAAAGGCTACCAGTGCTCGCCGCTAAGCAATGCTTCCATGGCGTGTACAGCTGGAAGTTACAGT
CTGGATGGCGATGGTGAGTGCACGCAATGTCCGAAGGGTTTCATGTGTGCTACCACAACGGATGTCCCTGTTCAATGTGCTAGTGGAACGTACTCCCCTA
CTACTGGCTCAGTCGAGTGTTTGGCATGTCCTGCTGGAAAATACTGTCCGCAGCCAAGCTCGGATCCTCTCGCATGCCCCGAGTGGTATTTTTCAGGGAC
GTCTAGTACTGCTTGCACGCCATGTTCTGCAGGAATGGATTGCTCGTTGCCGTTTACTTTGCCAGTGCCGTGTTTAAGTGGAACGTATAGTCTTGCCGAT
GCTTCGCCGTGTTTGCCGTGTCCGGCTGGATTTGCATGCGCGaacgcaacagcagcgccgacgatgTGTGATCCTGGAACTTTCAGTGCCCAAGGACAGT
CGAAGTGTACGCAATGTGTTGCTGGAAATTACTGTCCGCAGTCTGGCCAAGCGGTGCTGCTTCCGTGTTTGAGTGGGGCGTACGCTGAGGTTGGAGCAAC
TGCTTGCACGACATGCCCTCCAGGCATGCAATGTCCAGTGACAACTCAACCTATTCAGGAAACGTGCGCCGTTGGAACATATTCCTTGGGCGGCCAGGCA
CGCTGCATTCCGTGCCCAATTGGTCAAATGTGCCCACTGGTGGATGGCAGCCAGAATGCAGTGTGCGCGCCAGGTTGGTACTCATCAGGTGGTGCAGTGC
AGTGTTCAATTTGTCCAGCAGGTTACGCCTGCCCCAACCCATCGACTACGCCTCCAATTATTTGCTCGGATGGCTACTACAGTTTGGCTGGTGCCACGGT
TTGCACTGCCTGTCCGCCTGGGTATGCGTGCCCGGACCCGACGaccaagctgctcgttcCTTGTGCTAAAGGAACTTACTCGACTGGAGGAGCGAGTTCT
TGCACGCCTTGCCCTGCTGGCTTCTCGTGCGCATTTGCCAACAGTTCCAGCGTCGAACAGTGCCAAGCAGGATACTATTCGACGACTGGGTCTGGGTCGT
GTGTGGAGTGTCCTCGAGGTTACTATTGCGATACACCCAACGAGATGCCCAAGAACTGCTCGCTCGGTTACTACAGTTTACGCGCGTCTACGAGCTGTCT
TGCGTGTGACCCCGGTTACGAGTGCCCACGTTCGGATCAGTTGCCTCAGCCATGTCCCGTAGGTTACTACAGCGAAGGTGCTGTAGCAAACTGCCGCATG
TGTTATCCAGGATACATGTGCAGTCTTGCCTCGACGAACCCAACGCCACCTTCAGACGCATGTCCGATGGGTGGCTACTGCAACCCGCCAACTACATTTT
TCCTGTGCCCAGCAGGTACTTATGGCAACGTGACCGCAGGAGAGGTACGATTAATGCTATTAACGGCTTCCTACAATGCTCACTACTAACCCGATTTTGT
AACTCTTCGTACACTGTAGAGTATTGATCAGGCTTGTGCTCCATGTCCAGAAGGAAGCTACTGTGAAATGGGAACAACGCCACTGACGCAGCAAATTTGC
CCGCCAGGGTTCTTTTGTCCCGAAGGTACCATGCGTGCGTCTCAAAACCCATGTCCAGCTGGCACATTCAATTTGTTAGCAGGACAAAAGAGCTTCGACG
TCTGCGTCACCTGCACGGCGGGGTCGTATTGCCCGACTGGTACGTCAGAGCCTCAAATATGCCCCCAAGGTTACTACTGCATCGAAGGCACTCGAACGGC
GAGCCAGTATCCCTGTCCTCCCGGGACATTCAGCAGTACGCCTGGTCTGGTGACTGATTCGCAGTGCTTGACATGTCCGCTTGGCAGCTACTGCCCCCAa
ggcagcagtgcagcaacgAAGTGTCCTGCGGGTACGTACAACCCGCAGACAGGAGCAGCTGATCAGCACGAGTGCCTCAATTGTCCACCTGGTTGGTCGT
GTCCTCATGTGGGTCAAATCGACTATGTCGATAACTGTACACAAGGGCACTATTGTCCTGGCGGTACCGTTCTCGCAACGGACCACCCGTGTCCTGCTGG
AACATATACGGAGAGTATCGAGCTTAT