Description :
From Genome Similarity Track
Location :
scaffold_1379:422- 4182
Transcript NameFunction/comments
g11346.t1hypothetical protein

Sequence
3760 bases(100 bases per row)
CCACGGGCCCTTCCGGGATCTCGGGGGTTCCGATCGAGCTTCGACAGTGGCTTCCAGTGCTAGATTCTGCCACTCCATGTAGCGGCGAGATCCCACTGAC
ACGAAACCTGGAGATCTGGGCACTTTCTCTTGATCCAGTACCATTCCAACATTGAGACGATGATCTAGCCTCAAGATCTTCTCTCCAAGATTCGAGATCA
CGAGATATCGAGTTCGACCTGGACCATCCACCACCGTAGGTACCCACTGTTCTCCTCTGGTTACCCACAGCTTCTCCGTAGCACCCAACTTCACTCTTGA
TGCTGCCTCCTCCGATTCCCCGACTGGTATCTGCAGATCTTCCTCGAGAGTGATCGATCGCACCTTGTCACCGTACAATCTCTTGCGACCGTTAAGCGGG
ATCCCGACTTCGTCGGGTAGACACATCGACCCCTTGGCGAGATCCATCCGGACCCCGGCCGGAATCATGAAATCCATGCCCAGGATCGCATCCTGGCCCG
AGAGATCGCCGATCCATATGTCGAAAAAGTAGACCAGATATCCTGCCAGCGTGATCTTGATCCTTGTTCTCCCTTCTGTGGTATACACGTTATCGCCAAT
TCCCACATATTCCTGTCTCTGACTAGTGTCAAAGTGGCACCCAACCTTACGAGCAAAGGTGGTATCCAATATAGATACCTCGGCTCCAGTGTCTAGGAGC
AAGATCGCCTTCTCATGATTGATCTTGCCTGTGATCTTGGCTTGTCGGAACCACTTCCCTGGTGCATGATATTTCCAGTAACCCCGGGATTCTCCATTCT
TGAGATCCAGGGCCACCCCTGCATCAGATCGGCGGAACTCATCGATCTTAGGTAGACTCGCGATCTTGGCGGTGTATGTATGCAAGTCACATGTATTACC
GCGTAGATCAGACTCCTCCCTACCTCGATCTGCCGACGTCTTGTTCACGTATGCGTAGATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCCAACCC
GGTGAGCGTCCTAGTTTAACATCTTTTCCACCTTCTCGGGAAACATCCCTGCATATCGAGTCGGATCATACCACTGGCGGATCTGGTTGTAGAACTCTTT
CATGATGCATTCCCCGGCTTCGTGGACCTTTCCACAGCCACGGCACACATGTAGGCAGCGATCCGTCGGGTGACCCCTCTTCCCGCACTTCTCGTAGGTC
GATCGCTTCCAGCAATCGAGATCCGTGTGTTTCCTGGATCCACAATGCGAGCATCGACCTCGATCTTGGTGATCACGATCGGAATGGGTCCGGTGATCGG
AGATCCGGCCTCGATCTTGCGGGTGGGACCCGCCCCCAGCACCGATCGATTGATCATCAGCCGCGGCCAGGTAGAACTTTCGTAGATCTCCTTCAGAGTC
GGACCCATCTGATCCGGACACCCCTTCTGACTCTGAACTCGGGTCTTGGGCCTGGATCGCGCGCACTACGGCCCTGGCGGGTGCCGTGGGCGTTCTCGAT
GAAGTCTTCTGTCGATACTTCGATCCGAACGCAGATCGTCGCTGTCGGCTCTTCGCTCGTTCTCGAGCGCGGAGAATTTCCTCCCGATCGTCGACGTCAG
TCAGTCGAAGCAAGGTCAGGCGATCGGCCAGCTCGGGATCACCCAAAGTCTCGATGAAGTGATCGACGTGTTCCCGGCGGGCCTTGGGATTTCCGTCCTT
GATCTTGAGTTTGGCTCGCAGAGCCGCCACATTCAGACGATAGAGATAATCGAGCGGGGTTTCTTCAGATCGCTTGCGCGCATGGTAGTATTGCCACGCC
ACTGACATCTCTAGACCACAGTACTGGGTCTGGAAACTGTCAAGTAGATCTGCCCACTTGGTCTTGGTCGTTCGACTTAGTTGTCGGTACCAGTTCTTCG
CCGGACCGATCATGAGATCCGCGAAGGTGAGGCATTTCTCCTCCTCGGTGGCTTGATCTCGCTGGAACGCGGACTTGACCTTGATGATCCAGGCTCGGGC
GCGATCTTCGTCGAGATCCTTGCCGGCGAACTCCTTTAGATCCGAGATCGCCGAGATCCGGACTCTCTGGATCATCGATGTTCCTCCTTGCCCGATCGCG
GCTGTGGCCACAGCCGCCTGGCTCACTGTTGCTCCAGCGGGACTTGAGATCCCAAGATCATCCGGGTCATATTCCCACGAGTGCTGATCTGGGGTCCCGA
CTGACTGCATATCGACATCTTGCGCCCCCATGTACTTCGTGTGTGTGTGTGTGTGAGGAATCTAGGAGTAGCTAAATTTTGCTTCTTCAAGAACCGATTC
ATCGCCACATGGAAGTATTCATCCAACTTGCTGCTGGGTCCTGTCGAAGTGGTTGTCGGAGTAGCTTGATCTACCATGACCTGGCGATCTTCTCGTCGAT
CGGGTGTTCTAGCGACCGACTTCAACCCGACTGGTCGTTGATCTTGCTTCTTCATGCGTGTTCTCAACAGCTTGGCTCCGGAGAGACCCAGCAACATCCT
CGGAAGCTATCCGAGTCAGGCTCCGAGGTGACTGACGCATAATGCGAGGATTCGGTCTGATATCCAGGATCCAGCGTCTGCATGCGTTCACCTACCAAGA
TCTTGAGGGCATCAAAGAGATCTCGGGTCGCGGACCGGATCGCACCAAGATTCATGTCAAACAGGGAGTTCGGATCGAATTCTCCGGCAACCGGTCCTGC
TTCTCGAAGCAAATTCAGCAAGATCTTCACCGCATTCAGTCGATCCGTGACGATCTGAGGATTCGATACTGGGCCCGTCAGATCTCCGATCTGGCGGACT
TGTATGATCACAAGGACGGGATCCTGGAGCAGGATCTCACTCAGCACCTTTCGGTAATACGCCTGCTCGATCGTGTCCTTGGTGGCATTCGATCTCGACG
GGATCACGTCTTCGGTTTCTGAATCTGGCGCCTTCAACTTCGTCCGGGTAGTCTTAATCTTCTTCTTCTTCGTCGATCTTGGAACAACCGTGGACTTTGT
GAGCGGATTAGGTTTCGACTTCGCCGATTCCTTATCGCTCGGGTGCGGATCTCGATTCTCATCGAGATCCGCGGTGGCCCCCGAAGGGGCCTTGGGAGGA
ATACGAGGTTTTTCTTCAAGATCTGGATCCTGATCCAGGTCCGCCTCGTGTCTGTCAGCAGAGATCCTCCCAGAACTCTGCTGATCCGTGGATCTTGCTG
TATTCAGCGGTGTCTTCGTCGATCCAACATTCGAAGACACTTGTTCCCCTTGTTCTTCTTTCACCTTGACATCTTCTTGGGACTCACGGTGATATCCGAA
GTCACCAGAAGATCCGGGCACGCGCACCATTGTGGTGGAGCAGGATCCGCTAAAATCTGGGTAAGGCAGGTCTCGATACCACTGGCGCCCAGACACCGAC
TAACGGAGGGGGTCCCCCGACGACCCGTGATCTAGCTGTGTGTAGTATTCACCTTGTGTACCCGTCGGTAGGCGGGTTTCGCTCTTCCAGGTGGCTTCTG
AAGAGTCTTGCGGTGAGGGAAGAACGCCTTGACGTGACGCAAGGGTTTGAGGTAACGTGGAAATGCTTCGCTTTACCTCGGGGTACTTGATCCGGGTCGT
AGGCGAGTAGTCGAGTATTGATCCAGTCGTCTGGTCTTGATCCAGGTCTTGTAGGAGTCCAATATCGGGGATCTTGCCCCTTCCTTTCCGTTGCTTGCCG
CTTCCTTTAGCGGACGTCTTGAGGGGTTGAGATTCGACGTGATCTTCAGGCCAAGCAATC