Description :
From Genome Similarity Track
Location :
Scaffold_1271:422- 2069
Sequence
1647 bases(100 bases per row)
GTCTCGCCTTCCTTGATTCAGTGGATCCTGCACGATCTGCCGAGTTATCCTCTCTTCGCGACCGTGTGCGCCAAGCTGACCGCAAGTTGATCGCCCTTCG
TGCGAGTGCTGATCGTCTACGTGAACTCGAAGCTTCTCAGGTGCGTGTGGAGATCGCCAACACTAGCCGCCTTGCCCGCCAGGTTCTCACCGAGCCTGCT
TCTTCTCAGGCTTCCGCAAATCAAGAGCTTGCTGCCGCTCGTGTACATGCTGATTCCCGTGAGGTCACGTCGTCGAGCGCTGAAGTCTCACAGCTGCGCG
CCCGTCTCGACCTGTACCGCGAGGAGCGCGAGACCGTGGCGATCGAGAACAGCACGCTTCGGCGTGAGGTTGCCGAGATGCGATCGCGTGCTGAAGCCGC
CGAAGCTCTAGCAAGCGCGTCAATCGCTACGTCCAAGAAAGAGGCGCATCTGCTCGCCGAATATCATAAAGTCGGCAAGCTTGCCGTCGTGCGCCAGGCG
AACCAAGACCTCGCCGGCTACAGCGCACTCGGCACCGCCGCGGAAATCCGGCGCCGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCGACGCTGCA
ACCGTGCAGTTCTTGACGGCGATCTTGTCGCACACACGTGATGCTCTCGCAACCTACGAAGGGCTGCTTGGTCCGCTGATGTTGGCGACCTTCCGCCAGT
GTGGCGCTCTCGATTCGGCCATCTCGATGCTCCAGCGACACCGCCTGACAGCTTCCTCGGCTCCCATGTTTGAAGGGTTCTCGTAAATTTCTCATTTTAA
TGCATTTTTGACTACGGTACTCTCCTTGGGCCGGTTATCTCAGGGGTATCGCGCCTCGCGCCCGACAGCTACTCGATCAACGGTCAGTCGGCCGTCGACA
TCATGGCCCGTGCCATCTCCAACGCAGACCCGTCGTCTTCGGTCACTGTGGGAGACGAGCGTCGCCGACTCGTCGAGCGCTGCACGCTCCTTGTCCAGGA
ACTCAACGCCGTGCGTCCCGATCCTGACATCGCCCGCTTCTTGGCTGATATCGATGGCCAGCTACTTTCGATCACCCGGTCCAGCGATCTCGCGGAGGAG
ATTGCCGACGCCCATAACGCCCAGTCTCATTCGCGTCGCGATGAAGATCGCGACCCTCCTGCCGGAGCTGGCGCCGCGCCTGGCGCTAATGGCGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGCTCGGCACCTTCTCGCAATCGAGAAGCCGGTTCGAAGTCCTCGTCGTCGAAACG
CTCGCGTCCCTCGGGTGATGTGGCTGACTCTGCCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCGTCGA
CTTGACGAGCAGTCCGCCGCTGAAGTCGCCGTCCCGAACGGCCCGTGGCTCCAGCTATTACTCGCAGCCGGTTCATGAGACTTGCCGCGCGACTTGGGGA
GACTGGTGTCCCGGTTGGCCTGAGAGCGCACCGACTCTGGTGCCCACCGACCTCCTGCAGCTTCAGCGTTTGGCGTGGAAGTTCGGCTGGTTCCGGAAGA
GAGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN