Description :
From Genome Similarity Track
Location :
Scaffold_3:421946- 423792
Transcript NameFunction/comments
Phypa_INRA-310PPTG_01299hypothetical protein

Sequence
1846 bases(100 bases per row)
CTCATTCGTTGTGTGCAATGCTGTCGAATCGAGGTCACTTTTCGTTTAGCTTTGAGTCAGCGTTGCAATGAGTCTCGAAGAAGGTGCCGTGAAGCAGCCT
CTGAACAAACCACGGTCTAACCGCAGACCATGGGCATCTTGGCGTCTGGTAGCGGTCGCAGCGGTCGGCGCGCTGCTCGTAGTTACCCAGTTGACCAACT
ACTCGCCCCATTTCCACGCTCATATCGCCAAGCACCACATTCTTCGTAACCTTCAGGAACAACCCGCACTTCGACTTTCTTTCGAGATCAAGCGTAAGGC
CATGTACGTGCACGGGGCTTCGAACTTCGACGTTATCGCAATTCCGGCACTAAAGCGCTCGGCGGACGATCATAGTATGGTGTACAACGGTATGGCGTCG
TTCGAGGAGGACGGCCACACTCATGAGTACTCCCTCGTGGACGGCACGACGTATTACACACGTCGTTCTAATGGCCTCCCAGCATCGGAGGCCGAGTCGG
GATGCCTTCCTGCGGGCTCGGTTCCGCCTATCGAGAGCGTATTGAACGCCATTCACAGTGCGAATACCGCTACGCAGTCTGGTGCCTCGAACGACAAGTG
TCCCGGTGGATCTGTTATGGTGTTCCAGTTTGCGGGCGAAGACTTCGTTTTATGCTCAGACCAGTCGTGGCTTCAGGATGACGGATTCCAGATTTTCGGT
AAGCACTTAAACGTCGGTGTGAAGTACGAGCAAACAGCTCCGGTTATCGTCCCTCCACGCGTGTCAACGGAGTTATTGGACTCGTGTGGACAGGTCCCGT
TTGGAGAGCGTATCACTCCGTCTTTGTCGTCGATGTTGACTCGTTCGTTCTCTGAGTGGGGACACCGCTCTCTTCGCGCTCAAGAAGCCGAGGGTCTTTT
CGATAGTGCTTGGGATCTCATTACTGACGATAGCTGTGGCTGCAAGGGTGCTCAACGCGCCTGTGTGTTCGTCGCTGGTCTGAGTTCATATGACGACCAC
GGTCTGACGGAGGATGATCCGGAAGGCTACTTTGGAGACGAAATCGGTGATCACTCGCCGTGTTGTTCAAGCAGGAAGTACATCACTCTAGCCACCAAGG
AAAACTCGTGGAATGACCCTGTATTCCAGCAACGGCTAGTCGATCTGCTTGTTCAGGTGAGCGGTACAAGTGACCCGGTAACAGGAACTATCAAGGATAC
AATCTACGTTGGTCACTCGATGGCGAACCTCCTTCTAGCGGGAGCCATTGCCAACGGCAAGATTATTCTTGATCCGTCGACGACTTGGGTTTCTGCTAGT
GCCCCAATGGAAGGAAGCATGGGCTCCAACTACATCCAGGAATCGTGCAATGGACAGCAAAGTGGCTTCGTTGCCAGTATCATCGAGTTGCTGGGCAACT
GTCCTACGAACACTGGGGAGACGTCGCTTGCCTACCAGGGCACCAACTTCTCGTCGCAGCCGTTGAATGATGCCTACGCTGCTGCCCAAGATGCGTTCGC
TAAGAACGTAGACGCTGTCATGTGTAGCACCAGCTTTTCAGGCTTGGTGACAGTAAAGGCGGCTATCTACGCTCTGGCTGGGAAAATTCTACCGCACCAC
TCTTCTCAAAATGATGGCATCGTGGAATACACAAGCTGCTCCATAGGGCTTAATCAGGATATCTTCGACAATACTTACAAAAGTGCGCACTATCGAACTG
GCCTGAATCACGTGGACACGTCTTTCCGAAACGGAGATGGCATGTTCAACGATAACAAGAAGCCGTTGAAGTGGTTCGAGTGTCTCCTGTAGATGAGAAA
GATGGTAGGGATTTCATGGTCAGGAGCACGGTTACCTGTTGTGGAA