Description :
From Genome Similarity Track
Location :
Scaffold_70:42190- 45170
Transcript NameFunction/comments
Phyci_231785Hypothetical protein

Sequence
2980 bases(100 bases per row)
CCCCCGCGCGCAGCTCGAGGCCGCGCTGGACCAGACGCTGGCGCTGCTGCGCGCCGCGCTCAAGGCCGCGCCGGGCGCGTTGCCCGACCAGGCGCTGCAG
CGGAAGGCGGCGCAGGTGGCCGCGCTCGCCGGCCAGGTGCAGCGCCTCTGCTCCGCCAACGCCGGCGCCGACAAGCAGTTCGAGCCGCTGCAGCCGAGCC
ACGACGCCAGCGACAACTGGGACGCCGCCGCCGCCACGCAGCAGGACGTGGCGCAGCCCTCGGTCTGGTCCGGATTCTACAACAAGACGCTGCGCGAGCG
CTCGGACGTGCTGGCGCTCATGTACCCGCGGCTCAAGACGCTCAAGGCGCAGCACGCGGCCGGCGCGGAGGCGGCCGCCGACATCCTGCCGCCCTCGGAC
CCGGCCGCTAAGCTCGGCGAGCTGCCGCTGCGCACGGCCAACCTCATGATCGAGAACTGCATCGGCGTGCTCGGAGTGCCGCTCGGGTGGGTGCTGCAGC
AACTGGCGTTGCTGCTGCTGCTGTGCTGTACGCAGGCGGTTAACTGACTCGTTGTTGTGTCTGTTGTGTTGCTTGCTTTCGTCGCAGACTGGGCCTCAAC
TTCGTCGTCGACGGCAAGAGCCTGTCGGTGCCCATGGCCGTGGAGGAGCCCTCCGTGGTGGCGGCGGCTTCCAGCGCCGCCAAGCTCGTGGCCGCTGCGG
GCGGCGGGTTCCACACAGCCACGTCCGGCAACATCATGACGTCGCAGATCCAGCTCGTGGGCACGGAGGACATCCCGGCCGCGATCGCCGCGATCGAGTG
CAACCGCGAGCGGCTGCTGTCGATCGCCAACACGACACTCTGCCCCAACATGAAGAAGCGCGGTGGCGGCGCCGTCGACATCTACTGCCGCGTGGTGAGC
CAGGCGGCGCGGGCGACTGCCACTGCCGTTGGTGGCAGTGCCTGGTACAACAAGTGCGACGACGAGCTCGTCGTGAACGCGTCCGAGCCCCACACGCAGT
TCCTGGTCGTGCACATTGACGTGGACGTGTGTGAAGCCATGGGCGCCAACATCGTTAACACGGTGGCTGAGGGACTCTCCGAAGAGGTCTCGAAGATCAC
GCGGAGCCGTGTGGGTCTGCGCATTCTCACCAACCTGTGCATGCAGCGTCGCGCTCGCGCTACGTTCGAGATCCCTCTCAAGAAGCTCGGCTGGAAGGGC
GTGGACGGCGAGGACGTCGCGAACCGCATTATTGAGGCCTACAACTTCGCTGCTATCGACCCGTACCGCGCGGTGACAAACAACAAGGGCATTATGAACG
GCGTGGATGCCGTGGCTGTGGCCACAGGCCAAGACTGGCGTGCGATTGAGTCGGCTGCGCATTGCTACGCCAGTCGATCGGGACAGTATGCGTCGCTGTC
GCACTACGAAATTGGCCTTGCTGAAGACGGCTCCGGCACGCGCGTGCTGCGCGGCAGCCTGGAGATGCCTATCGCGGTTGGATCAAAGGGAGGTGCGTTG
ATGACGCACCCTGGTTACACTGCTACGCATGCAATTCTGCAGCAGCCGACGGCTCGCAACCTGAGTGGCATCATCGTAAGTGTTGGACTGGCGCAGAACT
TTGCGGCAATTCGCGCAATTGCAGTGACGGGTATTCAAAAGGGTCACATGGCTCTCCACGCTCGAAACATCGCTGTCGCTGCTGGCGCACCGAGCGAGCT
GGTGTCGGAGGTCTGCAGTTACATGTTGCTGCGAAAGTCAATCAATGTGGAGACAGCGAAGGAGTACCTGCACGCCCATGCCGTCTTCTCCGAGATCCAG
AGCAACTCGCCGCCAACCTCTCCGATCTCGGTGACGCTGCCGTCGATGTTTTACGTGGAAATTCCGATCCCGAACCTGGAGGGTACGATCAGCCTCAATA
TTGCATTTGAGGCTATCGACAAGCATCCCCAGTACATCGCGATCATGGCGCCGAACGCTGCTAGCAAGGGCGACAAGGTCCAGACGACGTTGCAGCGGCA
ATTGCTGGGCGACAAGGGCTACAATCAACTGGAGAAGATGTTCATGTTTTTGGCGTCCATGCGCTCGATCGTTATTTCCGCCTCCAACTCGGAGAGCGAT
CTCTTGGTGTCACGCTCGAACATTGGGCTGCAGAACAAGCTGCAACTGTTGTCGATTCTTATCAACATCCTCTCATACCGTCTAATGGAGGTGCGCCCTG
AGAAGATGCGCACATTTTTGAGGAAACTCCTGGAAGCGAGCAACGGGTCTGCTAGTGATGTTAATGATGGCGAAATGCATGAGCTCGACCCCAAGTTTTT
CCACGATCTGATGGTGGAGAGCGTCGAGCCTGGCGACGAGCTTCTTTCTACAGGACTACCACTCTTCCTTGCGCTGTGGCAGGTGCTGCACTACCACATC
GAGCAGGAGGTACCGCACAAGCTTCTCCGGGCTCGTTTGGTCAAGGAGCAGTGGGGACTGCTGAACGATATCGTCAGGAGCTACGAGCTGGGCACGCTCT
CTATCCATGGTGATCAACCGCTCGAGGAGCGCTTCTTGGCCTACGTGGCGGTGCAGGCTACCCGGTGGCAGGCAACGTTGCTGCTGCTAATCGACTCGCT
GGCGCTGGCGTCCGAGCTGGTGACCCCGGAACGGTTAGACTTCCTCACTCGCATCGGCGAGTACATGGAGTGGGAAGGCTCCGTCGCGCACGACCTGGCG
CGCTACCAGCGTGACGCTACGGAGCGTGTGCCTAACGCGTACCTCTTTTGGCTTTCGCAACGCGGGATCCCTCACTCGGAGGGCAAGGAGCACGAGCGCG
AGTTCCGCGGAGTGGCCGACACGTTGGCGGCGGAGAAATGGGATCAGCTGCTGAAGGAGGCGCGCCGAGACTCGTGGGCTGCAGCCACCTTCTCGTTGCC
GGCGGTGGAGCGTGTGATCGGCCTCATCCGCGAGATCTACGGCGACCATAGTGGTCGCAGCATCCGAAAAGAGTCGTTCT