Description :
From Genome Similarity Track
Location :
Scaffold_46:421864- 427001
Transcript NameFunction/comments
Physo_136563hypothetical protein
Physo_136564hypothetical protein

Sequence
5137 bases(100 bases per row)
ATCTCCGGGGGCAGCGTCCGATGCAGTCCGAACCCTCCCAGCGATGAGATCGATTCTTCCTCGCCCTCGGCTGAGCTGCTATCGCTGCTAGAAGCCCCAG
TATCACTGCACGAAGGCGCGACAGCCCCCACCGTCCGAAGAAAATGCTCTCGGGATACATGTGCAGTCGTGTCCTCACGATGCATCTTGGGGTTCGGTCG
AAGCGCCAGCGCCTGCAAAATGACCTGATAAGGGTCGAGTTCCCGCACCAGGGGCTTAAACTCACGCAGGAACTCCTCGAACGCCATGCACATGAGCTTG
GCCTCCAGCAGCTTGAGAATCGCCAGCCCTGCGCGTAAGAAAATGTCCTGCACCCCGACAAAGAAGAGATCGAATATCGCGCACGCGAGCTCCGTCTTGG
TGGACAGCGAGAAGAGCGTCGTGAACCATTCGATGCCGTACATGGGGATAGCGAAGCCCTGCGCCAGAAGGTGGGCGTGCAGCTTGGGCAGGTCCCGAAT
GAACATTTGCTCAAAGTGCTGGAGATACTCGTCCAAGAACGTGGAGCTGCGGTGGTAAATCCCGGCCAGATGGCGCTTTTTGAGCATGTAGAGGAAGAGT
GCGTAGGCGTCCGCCTCGGACAGCCCTTCCACGAGGAACAGCGCGGCGATGAAGTTCATGCCCTGGCAGTAGCCGTCCTCGGCCTCGGCGATGGCGTTCA
GCACGCGGAACAGCGCGCTCTGCTGCGCCGCGAGCTGGTGCTGGTGGCTGCGCTCGAAGATGCTGAAGGTGCGCGTGACGTCGCGGCCGATGGCGCCCGA
GCGCTCGTACTCGGGCGACGAGATGAGGTAGTAGATCTCTCGGTGGCGGCGCACGAAGTCCCGGGGCAGCACGCGCATGTGCATCCAGCTGATGCCGTCC
GTGAGCGACAGCAGCAGCTCGCGCTCCGATTGGTCCGTGAAGTTGAACTGCTTGACCACATTGCGCCAGAACAGCTGCCGCTTCTTCTCGCAGCCAACGC
CAACGCCAACGCTCGGCGCCGCCACACTAGATCCACCGGCCTCGTGCATATCGCAGTTCGAGTGGCGGCGCCGCCGGGTGCTCAGCTGCAGCTTGGGCGC
TGCTGTCGAGGTCTCCGCACTGGAGACCGAGTCGGTGGGACCCTTCGGAACCATCGCAGGCCAGGCCGTTGGGGCAAAACGACAACGCCTCGCGCTGTCT
CTCGCTGGTACGCGGCACGTTGCGGACTGACAATGGCAGTCTCGCCTTGTCCAGAGCTCTCTCTCTCTCTGCTTGAGCGTCGGCAGAGCGTCACAGCGGG
CGTCCGTTTCCTGCCGGCCGCGGCGCTACTTCTGAGCTTGAGCTGGAACTGCGGCAGCTGTTCTCAGAGCGTTATTTTTTTCGGCCAATGGCAGAAGATG
CGCCGCGTGACATGAAACGAGATTGGCTGAAAAGGCGCGAAAAAAGTTGGTGTGCGCGTGGTGTGCGGATACTCCAAGCCGCAGGACGGAGAAGTACTGA
GGATGGCGGCCACGGCCTCGTCCAAGCCCGCGCGCGGCGACGAGGGCGACTCGGCGCGCGAGAAGCTGCCGCTCAAGCCGCAGGTGGTGCGCATCGAGGT
GCTGGGCGACGAGAAGGTGGGCAAGACGTCGCTCATCTGCTCGCTCGTGTCGCGCCACTTCAGCGAGAAGGTGCCGAGCGTGCTGCTCAACGTGCAGATC
CCGGCCGAGGAGAGCGATGAGAACGTCATCATCTCCATCACCGACACCTCCTGTACGTAATTTATTTTATTTATTTATTATTTATTACCTTTTAATTAAT
GCAATATAGTTTACTTACATCGTTGGTGCAGCTCGTGTGTCCGACCTGATGCGCGTGACGAACGCCGCCAAGCGCAGCGACGCCATCCTGCTGGTGTACG
ACCTGACGAGGCCCGAGACGTTCCAGCGGCTGCGGCGCTGGCTGGACTTTATCGCCAAGAACAAGGAGATCCCCGTCGTGCTGGTCGCCAACAAAGTGGA
CATCAACGCCGTCACGCCCACCACGGACGGCCCCTACGCGAGCCAAGTGCGGCACCTGGTCAACACGTATCCGGTGGGTGCTGATGCTATTACAAACTAT
TTCGTATTGGCAATATCTGACAGTGCAGCGCTTTGGTGCTTTTCGTGTTGCAGTTTGTGGTGTCGGAGGTGGAATGCTCGGCGAAGAATTTCACGCAGGT
GGCGCAGGCTTTCTTCTTGGCGCAGAAGGCGGTGCTCTATCCTGTGGCACCGCTGTACAATGAAAAGAAACGGGTACGTTGCCCAATGGATTTTTGAAGC
AGCTATGAGATCATTCTTATGGAGGGGTACTTATTTGATGTGTGTTTGCAATGCAATGCAATAGCAATTGCAACCAAAGTGCCTGAAGGCGATCAAGCGG
ACGTTCCGTCTCTATAATCGCGATCGCAGTGGAATTCTTAGTCGAGAGGAGCTGAATAAGTACCAGTACGACTGCTTCGGCGTGCGTCTTCTGTCCACGG
AGATCGATACGTTGATGGAGTACCTTTCGTCCGAGGTGCCGTCTGGTGTGGCTCCCGATCGCAGCGGACTTTTTGTAGACGGATTCATCTATCTGTGGTG
GCTATTTATCGATCGCAACCGGCCCGAGTCAGGCTGGCAGGTGTTGCGAAGTCTCGGATACAATAATGACTTGCACTTGGAGATTCCGCCCGAGCGCCTC
CAGCTGCCGCCGTATGGAGACGACCAATCTGCGCAGCTCACTCCCCAAGCGGTCGAGTTCCTGACGAACCTGTTTCGCCAGTTTGATGCGAACAAGGATA
ACAATATTGCGGAGAACGAAGTTGAAGCCATCTTTTCCATTTGCGAGGACGAGAGTGCGCCTTGGACAACGTGCTCTGCTATCTCATCGCCACTTCTCTA
TGAGAGAACCATGGTAGACGGGAAGCCCACACTGTCGCTTGCCGTGTGGCTTGCTTGCTGGAGTTTTGTGGCCCAGGAAAACCCGCAGAAGCTTCTTGAA
ACGCTTTTTTACCTGGGCTACAATGACAAGCTGTTCCCGGCCATCGAGTTTGTCAAGTAAGTGTCGTGTGCTGTATGCATCCAGATCACGTTGAGATCTA
ATCACACACTACTTATTTTCTGATTAACAGGAGTCGCAGCTTGACGCGCAAGGCCATGAGGATCGATCGTAACCTGGTCTCGTGCTACATTTTTGGCTCA
CCGGGTTCTGGAAAGGAGCATTTCCTTCGTGCGTTTGTTGGTGGAAAAGAGGCACCTGTAGCAGACGATGATCAGTTTATTCTGCGCGGCATTGGGGCTG
TGCCTGACCGAGACACGACAAAATACCTCTTTGTAAGTGGAGTCGTTTGCGGCCAATGTGGTAGATATCTTGTTGATTGTGACGAATGTGTTGCGTGCAT
TGAGCAGATCACGGAAGCGTTGTCGGATGAGGAGATCGAGATGAAGGCGGATGTCCTGCTCCTGATGTTGAATCCTGAGGACGAGCCGAGCAAGGTGTTT
GTGGAGGAGCTGGATAAGAAGCTGCCTGCTTCGATTCCGCGCGTGGTCATCAGTTACAAGCCGGAAAAGCACAACGAAGACGTGGAAATCGACGTCGACG
AGAGCACTGCCTTGGTGAATGAAGAGCCCGTCGACTTTGCGATTGATGCGACGTTAAAGCAGTACCTGACGTCGCTGAAGTGCTACGAAGCGCACTGCGT
CAAGGATGAGGTTGCTCGCGCCCTCGTGGCTACTGCCTTAAGACCGTACGTGGTGGTTTGCTTGGTTTATACTGGGTGGTGCTTAAGTCTTATTCATGTA
TTTCTTTTTACTTGAGCAGCCCCAAGAACGCGCGCTCCAAATCTTCAGGCAGTTGGTTGCCAGGTCGGAAGACGGCGGGTGTGGTTGGACTGACGGCCAC
CGCGTTGGTCGTCGGTGCGTTCGTCGCGAAGCCGGAAGAGAGCAAGGCGGCTTTTAACGACATCATGTCCAAACTTCGGCGTTGAGTGTGTAAGTAGCTA
CGCAGCGAAAATACAGAGGGTTGAATCGCTTCAACGGTGTGCCAGGGCAACTTCAGGTCGCATAGGCCCGCTGCGTATCATGTCGCTTGGTTGACTCCAA
GTGAATGTTGAAGTTGCATGATTACGGAGAATTCGATCCAGGAAAGGGTAAAGGCCCAATCTTGGCCAATTTTGGTTCGCACCCAGCCGGGCTCGACTGC
TTTTAAAACTCCATGCGATTGTACATGCGAGATGCAGCTTAGTCAGACCCGAGCGCACTGAGCGCACTAAAGGATAGTCGTCCGAATGGCCAGCTATTTG
GAGGGTACTGTTGCTCAGAATGACCGTTTGTATTGCCCGCCCTCATTCGCACCTTCCTGTGTAATTACCAAGACAGAAACACATGTATGTTTGCGCCAAA
AAACGGAAGCTTCAGTTTCTAATTGTACGCGTTTTCACGCTTTTGTGAAGCCCAAAGCCCGTCGGATCTTCAACAACTGGGAAGGCACAATTTTTCTAAT
GGATCGGCTCGGCTGGACTTCATTATTTATGCGGCATTCCTGATGGAAAGGTGTCGTACTGGTACAGCAGTCGGATGCACTGATACCGTGAGCTGACAGA
GTTTAGAATGACAGGTAGGAGGAGAACGAACACCAGCTTCGAACGTAGCGCCGATACAAACTGCTTCCCAAAATGGGTATTCTAAATGGGCACTATTTCA
AAATGGGATGATTCACCTATGATTACGTCATGCTCTGTGCCAATAGAGTAAAGTTTGGAAAGATATTGTGATTTACACTTTACCTGTCAAGTTGAAGGCA
TTGCCGGGGGCGGTAAGATCTTAACCGGGCAACACCCAATGGAGACTCCTTTATCAAGCGTGGCCCGCGGGCCACACGACGCAGCGGACGCAATTGCCTT
CCACGTCCAGCTCGAGGAGCTTCAGCTAGCTTTTCACCAAAAAACAAATCCATGTCCAAAATCGTTTTTGCGCAGTGTGGTCCCACCTTTTTCGTGTCAC
GGTTGTCAAGGGAACGCCCAGGGTCAAGCTCGCAGGGCATCGCGCCTGGGGCCGCCATGCAGCCCTCCATTTCCCCCTGCACATTCACATCTTCCTTCGG
TGCGACGGCGCGTTGCTGCTTTCTCCCGTTGCAGTGC