Description :
From Genome Similarity Track
Location :
Scaffold_182:42178- 44037
Transcript NameFunction/comments
Physo_144368hypothetical protein

Sequence
1859 bases(100 bases per row)
TGGAGACTGCCGCCAAGTAGCCGACCACGTGCTTATTGTTCATTTCCGAACTCGCCTTCAACTGCGCAGATGTCCAAGCAAGTTTCTCCATCTCCGATTC
TCACGCCGCAGTTGACACCCTCCGTCACGGGTTACGTGAGCACCAAGCTCTGGGATGAACGACCGGCAAAGTACGCCAAACATGTGCTCAAGAACGTCTG
CATCATTCTGTTCATCCTCACGGTCTTCAGTCAAGTCGCGAACTTCGCCATCTCCCAGTCACTCAAAAACTTTTTCGTGAAGTTGGGTTGGTCCAACAAG
GGCTCCACATCGATCAAGTTGACCTACGACTCGCTCTGCCAGTTCATGTGCATTGTGGCCGGGTACATCTCGGACGAACGCCTCGGCAAGTTCAAGACTC
TGCTGTCGGCTGCCACACTCGATTGCTTTGGCCTTCTACTCATCGTTATTGCTGCACTGCCAGCTGTTCTAAACCACGTCGGTGCGAGCAAGATCATCTT
CAACATCGGTTTGTTCTTCGGTGTCGCCATTTCCCAAGTCTGCCTTCGGTCGCTCGTGGTCTCGTACGATGGCGATCAATTCTCGCCCACCGCTCCTCCA
ACCGAAAAGTCCCTCTTTTTCAGCATCCAGTACGCGGTCGCCAGCGTCGGTGCATTGATCGGCTTCGGAGTGTTTCCTTACGTCTCCATCCACGGAGTCG
GCGCCATCCCCGCCGAGTATGGCTACTTCAGCGTGTACGTCATCGGCTTTGTGATGATTGTCTTCTTCCTGGCAACGCTTTGGGCCTTCCGCAAGCGCTA
TGTGAACGTTGCTCCGAAAAAGGACTCTATCAGCCTCGTGATCAAGATTGTGGCGAAGCATGCTAAGAGGAACTTCAGCGCCAAGATGATCGTTCTTGGG
ACGATTCTGTACATTGCTGCGTTTGTGCTGAGCATCGCGGCCTCGTTCCTGTCGGACCACGGCGAAGTTGGTCACAACATCTCGTACGCGTGTGGAGTCA
TGATCGTCGTTGCGACGGTCCTCTGGGTCTACTTCGGTCGTAGCTCGGAGTTCATGGAATCCGCCAAAGACACGCTGGGCGGTCGATTCGACAGTGAGCT
TGTGGACGGCGTGAAGAAAGTCATTCGGATTCTGCCTTTCAACGCGTTCTCCGTTGTGTTTTGGATGTGCGAGAACCAAGGTGGCAACAACCAGTCGATT
ATGCAGCAAACGGACGTGCGTCTAGGCAGCAGTCTGGACGCAACTCAAGTACCTGGGCCTACGATTCAGATGTTCAACCCCGTTGGCTGCATTCTCTTCG
TCCCGCTCACGGAGAAGGTGATCTATCCCTTGTACACAAAGTACGCGGGCAAGCCTCCGAGCCTTTATGGGAGGGTGCTGGCCGGGTACTGCGTCATCGC
CGTGGCAATGTTCTGGACTGGCTGCTTCGAGGTTGTCCGACGCAGTACTTCTCCGCTGACCTACGTGGACGCGAACGGGGAGACCAAGTTTATTCTAAAC
GACGACGGAGACCAAGTGATGAATGCGATTCCGTGGTGGACAGGTATCCCCCAATACCTGCTGATCGCCTTGGCGGAGGTGCTCGCTGTCGTTTCGTGTT
ACGACGTCAACACTCGGAGGTGCCGCAGAGCATGCGTAGCACGTCTATCGCTCTAACTTTCTTCGCCAACTCCATGGGAAGTACGCTGCTCTCGGTGCTT
GTGCTGCTCCTCGGCAAGTACATTCCTGCAGACCTGAACAACGGTCACATGGAGTACGTGCACTTCACTGTCGGCAGCATCATGGTCGCTACAATTGGAG
TCTACGTCGTGGTGATGAAAAAAATGCAGCTGGGAATGATTCCTTCTGTAGGCAAAGAC