Description :
From Genome Similarity Track
Location :
Scaffold_62:42173- 49084
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_62-fgenesh-gene-0.12Splicing factor, arginine/serine-rich 12
Pytve_DAOMBR484maker-pve_contig_62-fgenesh-gene-0.13SFT2-like domain-containing protein
Pytve_DAOMBR484maker-pve_contig_62-snap-gene-0.20Phospholipid-transporting ATPase

Sequence
6911 bases(100 bases per row)
CCGATTCATGACGACGACTTGGCGTACTTGGAGCGCGCCAGCCAGACGCGGAACTCGGTCGCGCGCACGAAATAGTCGCTCTCGGTCAGGCGCGGCGCAC
CAGCGGGCAGCCGCTCGTCGCGGTCTCGGTGGCGGTGGCGGTCGCTTCTGGAAGACTTCTTCGACTCCTTCCTGTCCTTCTTGTGCTTCTTGCGCTCGCG
CCGGTCCTCGTCGTCGCTGTCCCGCTCGTCTGTAGGTGGGAATGTGACGTCCGGTGGTCAGTCCAAGAGTCCATGCATCGCTAGACGCAGGTCCGTCGAC
AGAGAGAGAGAGCAGCGGCGCGTACGGCGGCGGTGGTGGCGCTCCTTGCCCATGACTTCTCGCCGTTGACAACCAAAATGGAAAACAAACCAAGAGCATT
CGTTATGATCATTTCTATCCGTTATGACATTTAAACGCTGTTTCATTTGTCAAAAAGAAGTCTCATACACCACATGATTGGCTGTAAATCATCAGAATGC
ATTTTCAGTCAGCCAAATTGAACGTCAAGGCAAATTGGACGTCAAGCTGAACGAGAGGCAGGCACAAGAGAGCCATGTTCCTGCCGTTCAAGACCATCAC
CACCCGCCAGAGGTGTAGCCCACAGGCGTCCCGACCGACACTGTAGCTTCCTGCCTGTCTAACTGACCCTCCTGTTGCCAGCGTTGCGTACGCCGCGCTG
TGTCTGGCGCTCATGGGCGGCATCAAGTACCTGGACGACCACACGCCCGAGCACAACCCGCAGACCGCCAGCAACGACCGCCTGGTACGGTCTCGTGGAT
TTTTGAGAGAGCCCGACTGGTTCAACCACTACAGCCAGTACTAATCTCCGGCTCGTGATGACTGTGTATAGGCTTGGAGCGCCATGGACGAGCAGGCGGC
GCGAGGCTCCAAGAAGACGAGCTGAGCTGCAATGAAAAGTCAAAACGCGCCATCCTCTGTTCCTCAGTTACACCGGTCTGCCGTCGCCTGCTGGCCTCTA
CCGTTCGCTCGACTCGGAGCACTAAAACGGCCCGTTCCGAGTGCTTCCGTTGCGGTCGGAGAGTCAATATTATATGTCGTGCATGGTCGAATGGCTGGCC
GCTCATAAGCTGTCGATCACTCGGTGTTGGTGCTGATGGCGCCGTGGTCCCTCGAGTCGCTGCAGTCTGCTGTCGACCTCGCGCTCGGTACGCTATCCTA
CGCTGTGCCTGGTCCGCTGCTCGAAGCTTACTGCAGCAACCTGGCGAACGCTTGCACCATACGCCTCGCCGTCTTCCAGAACAGCGTTCCGAAGGCTGCA
GATACAGATCGAGACAAGCGTCAGTTAGTCTCTGTCGTAAACATGTTCCTCGTACAAACGAGCTGGCGCACCTTTGAGGCTGGCGTTGCCGCCTGGGAAC
GCCGAGAAGGCGAACGTCGCGAGCGTCAGCAGCTGCAGCACCGAGCTGAGCACCACGAAGATGTAGTTCCCGAGCACTAGACAGCTGTACAGCGTCGAGG
CTGCATTCACAACGTCACCATCAGCATTTCTCACAGCACGTTTGCATGGACACTAAGCTAGACGCACCGAGTGTGAGCAGATATGCCATGGTGAGTGGCA
GGCGGCTCGGCTGCAGCAGGCTCGCGGCGTACGCGGCCGGACCCTTGAGCATCGCGAACGCCGCCATCGAGCACATGCTGCCGAGCGTGAAGCTGAGCGC
GAACTTGGACGGCCGGATCATGATGAGCGGCAGGAACAGCGACGCCATGCCGAAGAAGAGCAGACCCATCAGCGCCATGCCCACAAAGTACTTGAACCGT
GTGTTCCTATCTCACACCCGCCAACATCAGCATCCAACACTCTCTCTCCTCTGACCAGCCACATTTGTTGCCTGCTTACCAGCTCATCGTGGGCAGCAGC
GAGGCATCGGCACCCGAGTTCTTGCGCCACAGCGGCCAGGTCGCCGCCGTCTTCTCGTCCACCTGGTCGATCTGACCGTTCTCCATCGCGTCGGCCTCCT
GGAGCGCCGCGGCATTGGCTGTCGGTGCCGCGCCGACCGCCGCCTTGGTTAGGTCGCGAGCCGAGTCCCACGCCTTTTTGAGCGAGAAGGAGGCGGGCGA
GGCGTCACCGCCGCGCGGACTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCTGGCGGTCGACGCCGTGGACGAGGACAGCGGCGAGTTGCGCAGCAG
ACTCTGGAAGGCGTCCTGCGCGGCCGCGAGGCCCGAGCCCGCGGGCTTCTTGCCTCCCCATTGCTCCCACGCGCTGCTCATATTGGCTTTCTGGTTATGA
GGATGTGAGAAGAGGTGAGGTCGTCCCAAAAATCGTGGTGGGATTTTCGCAGCACTGGAAAGAGGGGTACGTTCTGGGACGTGGAAGCGTAACCTGTGGT
TACACGCTGTATTTACGGAGATACCCGGTTATGGTGTTCATGTTGAGAATAGATGCAACTTTGAACCAAAATGCATGTTGAAGCCGAGAGGGGAGGTGCC
GCGTCTGAACTGGCCTTCCTGCCGCAGAGTTGCAGCCGAGGTGCCGCGCTTGAAGGCTCTCAACAGAGAGAAGAAAAGGCGAACGCAGGAGCACCTTGTA
TGCGCGGAGCTGGCGCCACTTGGCCCAATCTCGGGTCGAGTCGCGGCGACGGGCCCTGCAGTAACACCGCCGCCTGCCGCAATCTGAGGCTGGCCCCCCA
AAATAGGCCGGCGAAAGCACTGGCGTGTTGAGTCGCGCTCAAAGGTCGGATGGTCCCCGTCTCTGGCTCTGCTCGGTCCCCTTGCCCTCGTCCAGGCATC
TGTCTGGGCCATAAAGCATAAGGCACCGCAAATAGTGGGACTCTGATACGCCCTAGCCCTTGATCCCTCGAAAATACCAAAACGTTGACCCCATTCTCAT
GGGGCGGCCTCTTTCGTGTAGCGATATCGTACCTACCGTACATCGCGCATCGAACTGGGCTCTGGTGCGCACCGCGGGGTAGGGGAGTCTACAGCGCGAC
GTTGCACAACGCCAGGCCCAAATATAGCGCCCGCGGCGAAACCGAACCGGCCGGTTGCCCGGCACCTCCATTCGGCGCATTGTGGTCCGCCCGACGCCGT
CGCCTTGGCACCCCCGCCCTCGCCGCGGATGAGCGCGAGCAAGCCCCCGCGCCGGCCCGGCGCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGCGCGTCGAGGACGAGGAGCTGCTGCGGGACGCCTCGCCCAGCAACGCAGGCGGCGAGCGGCAGCTGCANNNNNNNNNNNNN
NCCCGCGAACGCGTACAATGAACTGGAGAGTCCGGCAGTCAGCGAGCAGTTCATCAACTCGGCGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCGTCCACTCGAACCATCGGCGCGGAGGCGGCGAGCGCACGCGCAGCCGGAAGCAGGGCTACTCGGCCGTGCGCAAGGACACGG
ACCAGGGCGAAGGTGGCTCGCCGCCCAACTCGACGAGCTTGACGATCTCCCCGCCGACGGATGCACCGGGTGCGCCCCCCCCCCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTCTCTGCGCGAGGTGTACTTCAACTACGCGCCGGGCAATGCGGTGTTCGACAAGAGCACCAACGTG
GTCATCACGTCCAAGTACAACGCGATCACGTTCCTGCCCAAGTTTTTGAAGGAGAGCTTCGCCAAGGTGGCCAACTTCTTCTTCCTCATGGTCTGCGTGC
TGCAGTCCATCCCGTCCATCTCCAACACGTACGGCTACCCGACGAACGCGCCAGTGCTGCTCTTCGTCATCTCGATCGACGCCGTGTTCGCCGTCATGGA
GGACAGGCGCAGGCACCAGTCGGACAACGAGGCCAACTCGGCCAAGTGCCACATCATCCGCAACGGCGCGGCCAACGACCACCTGTGGTCCGACGTCAAG
GTGGGCGACTTTCTGCAGGTGCGCAACCGCGAGGTGATCCCGGCCGACCTGCTCATCCTCGCGGTCTCGGAGCCCGTCGGGGAGGCCGCGAGCGGGATCT
GCTACGTCGAGACCAAGAGTCTGGACGGCGAGACGAACCTGAAGCTGCGCCAGGCCATCCCAGCCACCATGAGCGCGCTCGTGAACCCGCAGGAGTTGAT
GCACTTGCGGGGTGTCGTCAAGTTTGAGCGGCCGAACCCGTACATCAACAAGTTCGCCGGCAAGGTCGAGGTGACCGTGAGCGAGGGCTGCGGCACGGAG
GTCATGCCGCTCTCGGTCAAGAACGTGCTGCTCCGAGGCTGCAACCTCCGCAACACGGACTGGGTGTACGGACTCGTGCTCAACACCGGGCCGGACACCA
AGATCATGCAGAGCGCGTCCGCCGCGCCGTCCAAGTTCAGCGACGTCATGCTCACCATCAACAAGATGATCGGCTTCCTCTGCATCGGGCTCTTCTTCGC
GTGCGCGGCCGCCGCGACGTGCTACATCACGTGGCAGTTCGACATCATCGACAACACGTGGTACATCCAGCTGAGCGAGTCGGACCAGGAGGAGTCGCGC
GTCGTGTCGTTCATCAAGATGCTCTTCTACTACTTCCTGCTGCTCTACCAGGTCATCCCCATCTCGCTGTACGTCTCCATGACGAGTGTCAAGTTCCTTC
AGGCACGCTTCATGGCGTGGGACCGAGAGATGTATCACGCCGAGACGGACACCCCCGCGATCGTGCGTACGATGGAGCTGAACGAGGAGCTGGGACAGAT
CTCGTACGTCTTCAGCGACAAGACCGGCACGCTGACGTGCAACGTCATGGAGTTCCGCAAGTGCTCGATCAACGGTATCTCGTACGGCTCGGGCATCACC
GAGATCGGACGAGCGGCGCTCGTGCGAGCAGGCAAGCCGATTCCTGCTGAGCCCAAGCTGGACCCCAGTATCAAGAGGATCCCGTTTGTCAACTTCGTCG
ATTCGGCGCTGTTCCACGCGATGAAAGGCGGCGCGGGTCCCGAGCAACAGGAGAAGGTGCACCAGTTCTTCGAGCACCTTGCAGTGTGCCACACTGTCAT
TCCCGAGAAGCTGGAAACCGGCGAAGTGCGGCTGTCGGCTTCATCTCCGGACGAGCAGGCGCTAGTTGCAGGCGCGGCGTTCGCAGGGTTCAAGTTTGAG
AGTCGAAGCGTCGGTAAGGCTACTGTTGAGGTGCTGGGGAAGCGCGAGGTGTACGACGTGCTGGACGTCCTCGAGTTCAACAGTACCCGTAAGCGCATGT
CGGTCATTGTCCGTCGGCCAAACGGTGAGCTGTTGCTGTACTGTAAGGGAGCCGATATGATGATCTACCAGCGGTTACGAGAAGATCCGGCGATGGAGCG
GATCAAGAGCGTGACCCGCGACCAAATGGAGAAGTACGCCGATGACGGTCTGCGAACGCTGGCGATCGCAGTGAAGAAGCTCGACGAGCGGTGGTTCCAG
CGCTGGAAGGTCAAGTTCGACGATGCGCAGGGCGACGTGGCGGAGATTGATCGTCGCAAGGAAGGAAAGCCGAACGCGATCGACGACCTGATGGAGGAGA
TCGAGCAGGATCTGGAGCTGATTGGCGCGACGGCGATCGAGGACAAGCTGCAGGATGGTGTGCCGCAGTGCCTGGGCAATTTGACGCGCGCTGGGATCAA
GGTGTGGATGCTGACTGGCGACAAGGAGGAGACAGCCATCAACATTGCGTACGCCTGCTCTCTGCTCGACAACTCGATCCAGCAAGTCATTATCAACTGC
ACGACGTGCCCGACAGAAGAAGCTATCCGAGCGCGGCTGAATTCGGCCGGTCGCGAGTTCGTAGGGAACGAGAAGGGTGACAGCAACCGGGAGATCTCTC
TCGTCATCGACGGTGAAGCGTTGGAGTTGGCGTTGCAGCCTGGAACGGCTCCATCGTTGCTCGAGTTTACGAAACTGTGCCGCGCCGTGATCTGTAATCG
CGTGTCGCCGGCTCAGAAGGCCGAGATGGTGCGGCTGGTTCGCGACAACTTGACCGAAGTTCGCACGCTCGCTATTGGTGACGGAGCGAACGACGTGGCG
ATGATCCAAGCGGCTCACGTTGGCGTCGGTATCTCGGGTCAAGAGGGTATGCAGGCCGTCAACTCGAGCGACTACGCGATCGCCCAGTTTCGGTACCTCG
AGCGGTTGCTGTTGGTGCACGGTCGCTGGAACTACATCCGCATCTCCAAGCTGGTGCTGTACATGTTCTACAAGAACATCACGTTCGTGCTGGCGCAGTA
CTGGTACGGCTACCTGTCGGGCGGGTCCGGGTCCAAGATCTACTGGGAGATCGGTGTGCAGCTGTACAACGTGGCGTTCACTGGTTTGCCGATCATCGTG
GTCGGCGTCATGGACAAGGACCTCCCCGCGCCATTCAGCCTCGAGTACCCCGACTTGTACCGCAAGGGTCCGGAGCGCGCCTACTTCAACTTCTACACGT
TCGCGCGGTGGATCGGAGCTGCCTTCTACGAGTCGGTCATCATCTTCATCGTGATGGCGTACGGCTACAACGCGTCCGACACGGCGGCTGGCAGCGAGTC
CCGCGTGGAGTTCGGCATGGTGGCGTTCACGCTGGTGGTGCTGGTCGTGAACCTCAAGGTGTGCCTCATCACGGACACGTGGACGTACCTGTCGCTGGTT
TGCTGGCTGGGCAGCGTGCTGTCGTGGTTCGCGTTCGCGGCCATGGGTACCGAGGTCGCCTACTTCGCCACGTACAAGGTCGGATACGACGAGTTCGGCG
CGTTCGCCCCCACCGCCGACTCGTGGGGCTTCTTGCTCGTGATCTTCATGGGCTGCGTGCTCGCGCTCGGACGCCACCTCGCGTACAACCTGTACAAGCG
GTCGTTCTTCC