Description :
From Genome Similarity Track
Location :
Scaffold_211:42172- 44856
Sequence
2684 bases(100 bases per row)
GAGCAGCAGAAAGCTGGTCTAGCCATATCAAAACTTGGCAGCAGAGCCAGAGAATGGGCTCTGACGTGTGATGCGTCTGTAGACGCCGCGTTTCCCACGT
GTGATTCGCTTAAGAGACAGACGTCTCGCGTGTTCGCACCGCCTAATCAGGCTTATCGAGTGCGTTCACGCTTCTTATCTCCCAACAAGGGAAGAAGGAG
TTATCGGACTATGTACAAGAGTTGATAACTCTTCTTGCTGCTATACAATTGGATCCCCTTCCTGAGGAAGTCCGTGTCACCATTTTTATGGAAGGTCTCC
GTACTGGGGTCGCTCGGACCGAATTTTTTCGTGTCCACCCCTCAACCTTCGAGGAGGCTGTAGACATAGCGTTAAACGCCGAGTTTAATTTCAAAGCGGC
TTGCTATGGTACGCATGATTACGCCCAATCTTCGTTTGATAGGGTAGAGCCCATGGATGCCAGTCATGCTGATGATGACGAAGCAGAGCTTCAAGCTGTG
TAACAGCAACATAACATCCGTAGATGTTACACGTGCGGAAGCACAAAGCATCTCCGCCCCAACTGTCCAATGCGTAAACCGCGACAAAATCGGCCGAGCC
GTAATACCGCCCCAAACCAGAAATCTGGTACGGTGCGGGAAAATGTCGACTCCCAGTAGGCGCGGGGCTTTGTAGAGGCTCTAGGAGGTAGAGCGTAACA
GGGACTAGCCCCACACGATCTCGTGGACGTTGCCACGAAACGTATATACAAGTCAGGCTTGTTGGTTGCCTCGGCAACGGGTTAAGGGATTTGGAGAGTC
GTGGTCAATTTTGATTGACTTTGGGGCATCGGGCGACTATGTCCAACGCTGGTCCCTTGAAAGAAGTCAGCAGTATGCTGAAGCGCTGAAAGCGCATAAA
GGTGATGTTATCACGGTGCGTCTAGCAACGGGGGCCCTTGTCACCATACCTAAAGTTCTGTTGAACTTAGGTGTAAAGGCTTTAGACTTTAACATCATTG
AACGCTGTCTTTCCCTAGATTTGGACTCGATATATGATCTAATTCTCGGTACAGTCTGGCTGGAACGCCACGAGCCATGGATTGATTGGAGGTACAAGAC
CTTTGGCGCAACGCGCAATGTTTCTAGTGAAGCTTTGGAGATTCATGAACCCACCTTTTCTAGACAACAAAAACGCTATTGGATCGAGACACTGACTGAG
TCAGTTAGTGTGCTGGACATCGGAAAGTTTGAGTTAGTTGACTCTGATGTCAATGACAATAGTGAGAAGGCAAGTACTCCGTTGAGTGGCACTTGTTGTT
ATAATGAACCACTGGATGCTGATAGCATCGATGACCCCATGTCGATTCATTTAGGATGTGATCCCTTGACTTTATGTGCAGTGGCACCTGAACATCCACA
GAGTGAGGGCGGCTGCAATAGCACCTCTCTGAGTGTCAGTAATGACATTGCTGACGAAACGCTCCGGCATCAAGAGCGGGGCTCCTTCGATGCATGTGCA
GCGGCACGTGAGCATTTAAAGATTGAGGGCGGCTGCAATAGCACCTCACTGAATGTCAGTAATGACATTGTTGGCGAAACGCTCCGGCATCAAGAGCGAG
GCTCCTCTGATGCATGTGCATTGGCACGTGAGCATTTAAAGAGTGAGAGCGGCTGTCATAGCACCTCACTGAATGCCGGTAATGGCGTTGTTGGCGAGAC
GCCCAGACATCAAGAGTCTGATGTGCGTACAATGGCGGATAACTCGCCGGGTGATGAGTTCGAGTTAAGTAACTCTGCACCGGATGTAGGTAATGACATC
AGATCTTGTTTAGAGTACGCTAAGGCTGATAATGCTAATGAACTTGTAGGACCAGATGGTCCGCCCTCACTGAGGAGTTCAGCCTCTTTTCAGATACGGC
AGCGACGCCAAATTGCGGCTGCGAGACGAAAAGCGTCTGTAATGTCGCTTAACGATACTAGCGATCAGCTATATACATTGGTCGATGGCGTAACAGGTCA
CGTGGATGGTGAAGTGGGCCTTGCGGCCCTCTCATCATTAACTGCTCTGTTAGAGCTAGAAGAGTTATCTGTAGACGAGTTCAGTCAGACCTTAAGGGCA
GGCGACTTATCCGATATGGTGTTCCTTAGACCCGATAATGAGTTCAACTCCTCGTCTCTATTCGATGGGACGGTCCTTGAAAGTATACAGGCGGCACTTA
GTGCACGAAGTGGGTCATCTATTTTGGAGAACCCTCCAGACCCCTACTACCTTTTAATTAGGGAATTTCAAGATGTGGTATGTCATAATCTACCGTCTGT
ATTACCTCCCAATAGGGGCGTACGTCATGAAATTAACTTGGTTCCTGGAACCAAATACTGCGGTAAAAGGCTGTGGCCTTTTCCAAAGGAGCAATATGAC
GTCATTGAAGAGTTTCCAGTACTAAGCACGCGGCGGAAATGGTGCGGGAGAGTAAGTCTCCTCATTCCACACCGACATTTTGTGTAAAAAAAACTAATAG
TAAGTGGCGTATTGTGCACGCTTATAATAAGCTTAATGCGAACACTATATCAGCACAAACACCCATTCCTAGAAAGGACGTTCTTCAGAACAACATGACA
GGATGTACAATGTACGGTGCACTCGACCTGGTCGATGATTATTATCAACTGCTCATGCGAGCAAGTGATATCCCGCTTACCGCG