Description :
From Genome Similarity Track
Location :
Scaffold_30:421666- 422740
Transcript NameFunction/comments
Physo_134208hypothetical protein

Sequence
1074 bases(100 bases per row)
GAATGAATCATGAGAACAATGAACTCTTAACGTTCCCACTCGACCATGCACATACCTTCGTCTTCCTAAGCTGAATGCGGTTCAGAACATCACTGTACGT
GAATTGGTTCGACTCCGGGTCCAGCATGAATACCACGTGTTGTGACTCGCGCTGCAAAGCGTACATCACAAAACAAGACATGAGTGAGACAGCAGGCTCA
CAAACCAAGAAACACCAACGACTCGCCAACGTACGCTATCCAGAGACTCCACAGACATAAGATATTCTCGAAGGTACGAGAATTTTTCGCGGTCGTTGCT
CTCCTGTAAAAGTAATGTACGTGTAATTTGTGAGAAAATGTGTCATCACCAAGCTCAGCCCCCCCCCCCCCACACACACACACACGATCGTACCTCATCT
TCAGTGGACGCATTCGGCAATAGAATGGACCCTTGGATATGCTCGTTGCCAGCTTGAATCTTCTTGTTTACTCCGCACAGCAGAGCACGGTCCTCGCGGT
TTGTAATTCCCTTGTTCTTGACATCTTCGGAGGGCAGAATATCGTACGACTGCATATCACACGTACCCAATTGCTTAGTACAGCTCAAAACAGAGCAAGT
AACAGTGCATGCAGACCTTACCAGAATGGCGTACTTGTTGGCCGACAGATGCTGGTCGGGGAACACATCCCACACCTTGGCGATTTTTTTCTTCTTGTTG
TGTGGGTGCACGAGCAGCTTGGGGTCGTTGATGTCGCGGAAAGAAGCTTCGGCACGGTCCTCCAACGTGACTGACACCACCTCGGCCAGTGCGTTTTCCG
TGCCTTCGCGAAGCGCGCTCTGGATCTCGGCCTCGCTCTTGAACTTGTGCACCGAGTCGTACAGATCGTTGCCCATGTACTCCGTACGACGCAACCAGGA
GACCGTCGGGCGCACCTTGGACCGGCCCTTGGTGTTGGCGTGGTCCTCCTTCATCATCAGCACCTGTTCGTCGCCAACCTCCAACGGTTCGGGTTCCGCC
GGGGCTTCACAAGACGGAAAAACAACGACCGGAATGGCCACAATAATCAGCACACACGTTCCCCACCCCACTCA