Description :
From Genome Similarity Track
Location :
scaffold_74:42145- 46545
Transcript NameFunction/comments
g2820.t1 hypothetical protein PHYSODRAFT_481082

Sequence
4400 bases(100 bases per row)
CAACGGGAGCGCCGAAACAAAGCCGCCATTTGCATTCAGAAGCATGCTCGACGAATCGTGGCCCAGCGAAGACGCATTGTGCTCAGTAAAATTGACCATG
TAGAAAGATGCCGACGTCAAAAGGCCTCTGAGATTGCTGCACGAGCAAAGAAAATGAAGATGCACGGGGCTGCAATTTCTATCCAGCGCGTTTTCCGAAA
TTGGCAGGAGAGGCGAATTTTGATGCTTCGTCGTCGTCGTGCAGCTTTTGAACGTGATAAAAAGAAGATTCTTAACGTACAAGCACACTACAGAGGACAA
CAAGCGCGTCGATGGGTAAACAAGCACAAACGCGCCGTTTCAAGAGCAGCTCTTGTTGTCCAGTGCTCTTGGCGGTGTTATCTTTCAAGATACGAGCTCT
GGAGACTCAGACAGCAAGTCATTGCTCGACGTGATCAAGTTCTAAGAGAAATCGACGAAAGCCGTCGTAGCAGAAAGGCAAATGCTCTTCCAATTCAGCT
ACAGAAGAAGTGGGGTCAAATTTCACTGCTCAAGTCCAAGCCAGGTGATGTATCGAACTCTCGAGAGGTCCAGGCTGCTAGGAAGTTACAGGCAATGTGG
AGAGGCAAGCAAACCCGCAAACGGCTTCGGTACGAAAAAGCAAAAGAGATGGAGAGATTACGGCGTCAAGTCAATCGGAAGCGAAGACTCGCAGCGGTTT
GTATTCAAAGACGTGTTCGAGGGATCAAAGGCCGCGCGCTCGCTTGGCGAATGATGGAAGAGACGAGTGCAGCTCGGATTCAAAGAGTATGGCGGGGGTA
CAAAACTCGAATCCAACTCATACAAATGCGGTATGCCATCAAGATGATCAATCGGATTCAAGCACGTTGGAAAGCTCGACGGAACATTGAAAACCAACGC
TTTCGTGCTATCAATGCAGCCACTATCCAGCGAGCGGCTCGGCGCATTATTGGGCGTAAAATGCTTTTGACTGCGGTTCAACGCCGGCAATTCCTAGCAG
AAGAGAGTGCTGTGGGGAAGGTCTTGGAGGAAAGGACCCGAATTCGTGTGAAAGATGACCTTTTACTGCAAAGCTTTATCTTCAAGTCAGTAAAAACTGC
AGACGAGAAGGACGGGAGTTCACTGGAGGAATTCCGTGTTGACCGCGCGCTTTATAATGTGGATTTGGCGAAAAAGCAGTGGAAACGAAAAGGCTACGAT
GGCATTTGGCAGGAAGTCTTTCGAAACGCCTCCGGTAACTCTGTGGAGATGGATAATTCTCATTTCGTACGGTTCCTCAAGGCCTTGCCGCATTCATTCA
TACACAAGACTCATTTTCCGCTGCAGAACGCTGATGTTATTTTCGCAAAAATGAAGGAGCCAAAGGCAAAAACAATCTCATTTCCAAGATTCAACAAAGC
AATTTTGATGTTGCTGAAAGACAAATTTGCAGATCCGAGTAGCCATAAGGAAGCTGCAAAAGGACCCGAACCCGTCGATACTAGTAGTGACAACGAGCGC
TTCCTCCGATTCATGAATCGATTTGTGCTTCCTTCAACGATTCAGAACGGAAAATATAGGAAATTGATCGAATCTCACTGCACCAAGCGCCTGCTTTGGT
CCGTCGCAGTACTACGGCGGTTCACGAATCGAATCGCGACCAAGAAAAAACACGACGAATTTGTAGTGATTTTCCGCGAGCAGCAGATACAGAAGCATCG
GAGCAAGTGTGCTGCAACAATTCAGCTTGCCTATCGGTGCTACAAGTTTCGTTTGCAGTTAAAATCGATGCTTGCCAGTATGTTTATCGACTTTATCGAC
CATACGGGGCGTACAATTAAGTTCAAGCACATCGCCAGCGGAAAAACTTTTACGAAGAGACCGATTTTCTTGAAAGGAATAAAATGCGGTAAGATTGTGC
CGTTGCCGTTTCCAGGGGAAGAATTTCATGCGTTTTGCGAACGCCACGAGGACAGCACAAACCCAGACGCTTCGAAGGTTCCTGCCCAAGTATATTGTGC
GGAGTGTGAAGATGCTATGTGCAGAATCTGCTTTGATCGAGACCACAAAGCACGGAAAGCCTTCCAAAAGCACTTGCCACGGGAGATCCAGAAGTGCAAT
CACTGTGGCTCTGAAACTGCGACGAGAGAGTGTCTTCAATGTGGCAATGGCAAAGTCCCATTTTGTGATCCCTGCTTCCCCCACGTTCACAAGCAACAGC
TCGCAAAATCTCCAGGAGGAAAGGAGTTTGACCGTAAGTTTGACGACACCAAGACGGCTGATAAATCGTTTGATGGGCATCACCACAAGTTCCAGGCTCT
TGTGGTCATGTGTGTTGAGTGCTCTGAGCGAGTGGCTCAGTGGTCCTGTGAAACCTGCTTGGACGTCTTTTGTAAGCGTTGTATGAGCTCCTACCACGCT
AAGGGACAGCGGCAGCACCATCACTGCCACCGGTTAAACTACTTTTCTATTCTTCGACAGGTAGCAGAACAGAATCGAGATGCAGCCGTCGAAAAGGAGC
GAGAGAGACGTAAAAGACAGCGTGAAGAGGAGAAGCGACGACAAGAAGCAGGACTGAAACGACAAAACGTTGCCGCCACAAAGATGCAAGCGCTGATTCG
GTCTTTTGTTGCTCGCCAATCCGGAAAAGCTTACATGAAGCTAGTCCGACAAACACAGGCGGCGCGGGCACAACGGAAAAGGGACGATAAAGTGCGGGCT
ACGCTCTTGTACAAGATGAAAGCTGCATTTGGAGTCTCTCCAGCCCTGAAGTCAGACACGAAACAAGAGGTAGCAGCACGCCGGCAGCGAATTGAAAACA
TTAAGCGCACTTTGTTCCTTCAGCGGTTACCAGAGGACAAGTCGGCTCCAAAACACTGGAGTAACAAGCAAAAAGCTCGGGTTTTGGAAGCTGCCCGAAC
GTGGTGTGACTACGACGAACCTGTAAAAATTCTCAATGGAGAATGGAAAAACTGTGTTGGAACAATTGTTTCGACACAGAATTTGATGCTGACAGGAAGA
GTGCTGGTGTTCGTTCGAGTTGCGAATCGGTCTGCAGTTGTTCGTTGGGAGGGCCTCAAACCGTACGACCAAGACGAGGCCTTGCGCCAAGCCTACGAAT
CACCAGGACAAGTGGCGCTGAACGTCACGCACGATTTTCATATTAAAATCTCCCGGGTCTTGGAGGCTGCCGTTCGAAGAGCACGCCTACTGTACTTGCA
AACGATCGAGTTCAACCGTATCACGCAGTACGCGTGGGTCGTGGAGTACGACAAGCGAGAACGGAAAGTGGAGTACTGGAACGTGGTTCTCAATAGACGT
ATTGCAACTCCTCCAAAGGCGATGGAGCTGATCGAGCGGATGGAGATTGAGGACCGTGAGAAGCTGGAAAAGCGCGTCGAGTTGGCCAGGAGCAAGCTTG
TCGCGCTTCTAAACCCGTTCCAGCCGAAGAACAAACTTAAACTGGCGCTACGCAGGAACGCTATTGTGTTTATCTCGAGTGGTTTCGATCCAGAGGAGAG
CAACAGCTCAGTTTTATCTCTGAAGCGCGAGATGGAAGCGATCGACGGCGCTCGCTTTTGGCACGACAAAGTGGTTCCGAACCGCCATTTCGGTGGCAAA
AAGGCCAAGAGATTCCTCTCTGCGTCTCCGTCAACTGCTTGCTGGTCGGTCGTGAAGCTGCTCAGCTGGATGGACTTACACGAAGACGGAGGCTTCGAGC
CGCACGCCAAGAAGTTGCTGAGTCTGACGGAGGAGCTGCAGATCTACGTCGTTCGGGAAGTGAGCGGTTGCTTGGAGAGCTCCGAAGACGTCAAACTCGC
CCGGGACAAGTTATTGCAGCTGATAAAGCTGAAGGAGGCGACGTTACAATTGTTAGTGACGAAGGACCAGCGAGATGCCGACGAAGAAGAAGCCCGACAC
GCTAAGTCGTAAAATAACCGCTAAAAAGGCAACTTTCACTTCAACTCGTACATAGCGCAGATTGTCAAAATGAATTTGAGATATCTTGGAAGTCATGAAA
TATATGTGGACAGAAGGTTGCTCGAGTGATTGGACCGGGTAGTCAAAAAGTGACGCCAGCAGCGACCAGTCATTCGTCCAGCCAACCAGTGGCCTGCCGA
GCCGCTTCATTCGCCTCGCCCACGCAACAAAAGGGAAGTTCGAGCTAACGCATCAACTAGGAAACAATGGGTAAGCTTTAAATATGGAGGCGCTTTCCTC
TGGCAATAGACGACGGCGTAAAGGCAGCTACGAGCACAGGCAGGGGCAGGTTCCGACAGCGCTATCAGAGCCCAATCAGTGGCTTCGAATAGAGGACTCC
ATCCAGTTTTAGGACAATATCAAGCGACTGCAGGACAAAGATGACACTGGGCCTTGAACACCTTCAACCGCTTGCTTGTTCGCTTCGTAGCGTTTTGCTG