Description :
From Genome Similarity Track
Location :
Scaffold_210:421436- 423671
Sequence
2235 bases(100 bases per row)
GAGTACGAGGACGTCTTCCTCAACGAAGTACCCTGCAGCCTGCCCGTCGACAAAGGCGTGCGGCACGAGATTGATTTGGTTCGGGGAGCCAAGTACTGTG
TTACGCAGCAGTGGCTGCTCCCTCGCGAACAAGTCGAAGCAATCGACTCGTTCTTCGCGGCGCGCAAGAGCGCCGGACATGTCCGCGAGAGCACATCGTC
ACACAGCAGCTCGACCTTCTGTCTGTAGAAGCCCAATGACAAGTGGCGTATTTTACACGCCTTCAACAAACTGAATGCCGCAGCAATCCCTGCGCAGACG
CCGATTCCGCGCAAGGATGTGATTGTCGGCAGCATGAGCGGGTCGACGATCTTTTCAACCATTGACCTGCGTGATGGTTTCTACCAAATTTTGATGCGCG
AGAGTGACATCCAGAAGACCGCTGTCTCCACTCCCAGTGGCATGCTCTGGGAATGGCTTGTTATGCCACAAGGCCTCTCCAACGCCTCTGCAACGTTCAA
TCGCAAGGTCACGAATAAGTTTCGAGCGATGCACTCCTTCGCTCCTTCCTACTTCGACGACATCTACATTCAGTCGCGGCACCGCGACTGCCCCCGATCG
TGACGTCCTCCGCGCGAATGGCTTTTACGCCAACTTTTCGAAGTGTCTCTTCGGTGTCGACGAGATCCCTGTTCTTGGTGACCTCGTCGGCATTCGTGGT
TGTCGGGCGGACCCGACAAAGTCAAGGCTATCGTGGACTGGCCGACGCCAACTTGTGTCAACGAACTGCGTCGTTGGCTCGGCCCTGCCGCTTACCTGTA
CAAATTTTCTTTCTGCTTTAAATTTTAAAAATTAAAAGTACTCGGCGAACTTTGCCGACATCGCCCAGCCGCTCTTTCGCTTGCTGGTCAAAGACGCCCC
TTGGGTGTGGGAGGCGTCCTGTGAAGAAGTCTTCAAAGCACTGAAGTCGAGCTTGCAAAGCGCCCCGATCTTGGCGCTGCCCGAATTCGATCGACCCTTC
ACCGTCGTTTGCGATGCGTCTAAGTTCGCAATCAGTTGCTGCCTGATTCAGCCGGACAATGACGGACACTTCAGTCCTGTTTATTACCAAAGCCGCCAAC
TCCATGCGGCTGAATGGTCGTACCCTGTTCACGACCTCGAACTGTTGTGTCGATGAAGTATGCCGTCACAAAGTTTCGAGTCTACCTGCAAGGCTCCAAA
CCTTTCATCGTTTTCACTGACCATGCGTCGTTGCGCACAACCGTCAACTCACCGCATTTGCCGAGTTCAACTTCACGGTCCAGTACAAGCCCGGCAAAGA
AACGTGCTCGCGGACACCCTCTCAAGGCGCCCGGATTTGGAAACACCGATGATCCTAGCCGCAGTCGGACTGATCCACTCCGACCTCCACGATCGCATCC
CTGCTTTGTTCGCCTTTGACACAGCATGCTCGTCCATCCTGTCGGCCCTCACTGCGCCGCAACCGTCGAAACCGCGCCGTTCTTTGCCTTTGGCCTCGCG
GTATACCGTCGACAACGGTTTGATCATGTTCAAGTCTACGTCGGTTTCGATCCCGCGTATCGTCATTCCTGGTGACGCGCAGATGCGCACGAATTTGTTG
CGCACCTACCACGACTCTCCCTTTGGCCGCGACGCGATATACGCGGCTCTGTCTCGTTCATACTGGTGGCCTCGACAGTACATAGCCGTCGCACGATACG
TTGCAAACTGTGATGCGTGCCAACGCACCAAGACCACGACGCCATCAAGGGCTCCGCTGCAGCCCTTGCCCATTCCCGATGAATTGTGGTCGTCGGTGAG
CATGGATATCATGTTTGGGCTGCCGCGCAACGCCCGCGGCAACACCGGCATCATGGTTTGTGTCGACCGCGCGTCCAAGTACGTGGTCGCGGTGCCCGCG
AAGGACACCATCAGCGGCTCTGATGCCGCTCGTCTCTTCTTTGACCACGTCTGTTGTAGTTTTGGTCTGCCGCGGTCCATCGTTTCCGACCGCGACCCTG
GTTTCATTCGAAGTTCTGGACGACGCTTTACTCTCTTTGCGACGTCCACCTCGCAATGTCAACCTCCGACCACCCTGAGTCGGACGGTCAGACTGAACGC
GCCAACCGCGTTCTCGAAGGCATCCTTCGAACGTACTTTGTCGCATCGTCCACGACGTGGAGCACCCTGCTTCCCTACGCCGTGTTTGCCTATAACGCCT
CGGTTCAGGCGTCCACGGGCTTCTCGCCTCACTAC