Description :
From Genome Similarity Track
Location :
Scaffold_50:42135- 43232
Transcript NameFunction/comments
Phyke_g2488hypothetical protein

Sequence
1097 bases(100 bases per row)
CCGACGACAAAGTGCAGCCACCTGCAGATAATGTTAAAGATGAAAGTACGGGTAGCGCGCGTGGAGTTTTTGAAGAGACATGTGTCGTTACGAACCACAA
TGATGAACTAGAGTTAGCTACGCTTCCGGTTGAAGAGGGAAGCGTATCTAGCGCGGATGTCATTGCTGAAGGGATAGTTCCAATCCAACATGAAACTACA
GGTCAGAACGTGAAAGAAGCCACTGACAAGGCTAAACCAATAACGTCAACCGATGATCGAATTGAGGAAATCCCTACCAAAGTCCCTGTTGAAAACAAAG
CTGTTGCAGTAGATGCGCCCGAAAGTGCAGCGCGACCTGACGACGCACAGTTAGTTGGCGACTCTGAATTACTAAACGAACACACTGGTGTCGACGTTCC
TCTTGATGTGCTTCCAAGTATAGAGCTAGAAGAGGAAACATTGGAGCATGAAGATTCATGCACCTCCCAATCACTTAACAGCGAAGGTGAACGCGGACAA
GCTTCTGAGCCAAATCCTTTCATTATGGAGGACTCGCAAGCTGTCGAGCCCATTCACCCGCTAGGCGCCAAAGTGAAGGAGCTTTCCATTACGTTTGATG
AACCTAACAGCGTGCAATATCCAAGCAGTGGCACACAAGTCATGGAGAAAACTGCATCGAGTTCAAGCGTTACTACAGACTTTGTGAGGGCCTCATCTAC
ACCGCCGATGTTGGATATCGATGCGCAGGGTACTGCGCCAGGTGATACTCTGCCTAAAACCTCATTATCCGCAGTTTCGTCAGTTAGAAGCTGTAAGAAT
TTGAAAAAACACACTCCAACTCAAGTGCAGCGCCAAGAACGTGCATCACATTTCACGCGGTTGCCGTCCGTTTTAGATGTGGCAAAGTATTTCCCGTCTA
GACACAATGTGTTTGCTCCTGTCCGCAAAGGAAGTATAGATAATTCAGCAGTACCCGTGGCCATTACACGGAAGAAGATCGAGAGTTATTCACCTTATCG
TGTGCACCACTTGTCCCAACGAGAGTTAGAGAAAATGGATGCACACCACCAACAAAATCTGGAGGCTCGGAAGACAGAGGAAGACCGTGTTCAACGT