Description :
From Genome Similarity Track
Location :
Scaffold_16:42117- 45579
Transcript NameFunction/comments
Sapdi_VS20SDRG_05866hypothetical protein

Sequence
3462 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATATACGC
CTTGGTTTCTGAAGCACTCACGTCGGCGCGTAGCGCACGGCGGCCGTATGTAGGCTGCCTGTCTTCTAGCGCATCGACCAGTGGGTGCAAAGTCAAAGCA
TGCATGATCATTTTTGGCAGGGTTTTGGAGAGATATGCAGCTGACACACGCGGGCGTCATTGGGTTGATGGGACGGGCTGGGATACGCGCGCGACGCGGC
CGCGTCACCGGCGCATCATGCATGGTCGTCGTCCGTGGCGATCGACCGGAGCCAGTCGTCCGGACCCAACGAAATGACTTTGGAGAGCTGCTGAACGTGG
TCGTACGTGGGCTTGTGCACCATGACGTCGCGCGCGCTCTCGAGCAAGTCGGGCGCGTTCCAGAGCAAAATGCCCACAATCTTGTTGGCGCGGAGGTAGT
AGACAAGGCCGCGCTGGTAGCTCTCGTCGGCGCCAAACTTTTTGGGTGGCGACAGCCACACGCCGAGCGTCTGGAGGCGGCTGTCGATGTCGCCAATGCC
CTCGATCGTCACGTGGATCCCGGGCATGTGGCTGCGAAACATGGGCTGGTGCCGGTACATTTTCTTGGTCGCATTCACCTAATGCCGGTGCTTAAGCCCA
CGAATTTCAACATCACGACGACAATATTTACCATGTTTTGGCCGGCAACGAGCCCGCTGTTGACCGCGTGGTCGTACCGGTCGACGCGGCGTCGACCAAC
AAACGAGTCGTAGTAGCTCGCGACGCTCCCTGCAACAAAGAGGTCCCGTACCGCCTCCAGCTGCGCGTTCACGACGATGCCTACAACAGTGTACTTTCCA
GTGGCGCAAAAACACTGGATCCGAACCGCCGTGCAGCGCATCGATCTCGAGGCCGTCAAACTGCCCACACTCGACGTCCGGTTCAATTTGAGTCGATGCG
AGCACAGCATAGTCGGTGACGACGTCGGCGGTCGCGGCCCCCATGCACGAGAGATGCACGCCGCCTGTCGCAATGTCGGGCTTGATACTTGTCACCAGCG
TATGCGTGTGCACGTCGACGTGCGCATATGCCTGCAGCCGCCGCGTAATTTCCGCACTGAGATACGCAGGGACGTGGCGCGCGCACGGGCCTTGGCCGTC
GACAAACATTTGTTGTACCTACGCGCCCGGTACATCTACCGGCATCCCATCGACGCTGAGTACCTGCAAGTGGCTGTTGCGGGGGTCTGTCGCGAGCGCC
ACCGCCACCTCGGTGCCCAGGAAGCCGCCGCCGACCACGGTCACGGACGTAATCGCCCGGCGTGTCGAGAGACGGTCGAGTGCGCCAAAGTCGGAGAGCG
TCGTCACGGTGTTGACCTTGTCGCGAAGCGCATACGAAATCTTGGAGCTATCGAGCACGTACAAGGGCCGTGGTCTGCCCGCCGTCGCAATGAGGCACTT
GTCGTACGAGATCTACAGGAGAAGAGATGTCCATCGTTGTATTCCAGTGCGAAAGCAGGGTTCGAAGCGGGTACGACCTGCGCATTGTCGGGCAGCGTGA
TGCGCTTTTGCTCGACGTCGACGTGCAAATTCTGCATGCCGAGCACGAGCGAGACGGACGGCGTTGCGTGCTCATCGTCAAGACGCGGTGTGATATACCG
GCGCCACTCGTTGTACGACTCCATGAGCGCGTCCGAGAGCGGGGCGTCGCTTGTCGGCCCGTCCTGCGTCGCATCGAGCCGCGGCAAATGCGTCTCTTCG
CTGATCATGAGAATGTCGGCAAGTGGGCTCTGCTGCAAAATAGCCTCGATGGCAGCGTGGGCTGCGGTGCACGCGCCCAGAATCACGTACGGGTAATGCC
GTGGCACAGCGCCCTCCGTGGCTTCGGCCGCTTCTAGTGCAAGATTGTGCGAACTACAGTGC