Description :
From Genome Similarity Track
Location :
Scaffold_18:42112- 43462
Sequence
1350 bases(100 bases per row)
TCCTACAACTTCAGAAAAATATTTGTCGGAAGTTTGGACAAAATATGTATGCCAGAATACTGCAATCGAGACAAAAATTTTATGTTAAGAATATTTTTGT
CATTCAGACAATTAGGCGTGATCCTAACCTAGGTCACATGGAGAGGAGGAATGTTGACAGCCAGTCGTCACTAACTAAAAAAAAACAAGAGCCCACAACA
GACGAGACACCATGAGCCTCACTGCGTTCGTCCCTACGAACACCAAACGGGCACAGCACGATGAGGGTGTCAGCATAGATTTTGTTCAGGCAAGTATTAC
CATGGACCCTTCTGGCAAACGGCTTGCCGCTACGATGGATCGATTCGGCTACTATCTCGGAACTCAAGAAGATAAGACAGGTAAGTTAGCTCGTAACACA
GCGATTTCATACTACAGAAACGTCAAACTTTGGTTATTCGACAAGTATCCTCACTTGCAAGTGGCTACAGAGTTGATCTTGCTAAAGCAAAAAGCAAGGG
AAAACGCTAGAAAACACTGTTTAAAACGTAAAAATAGAGACCTCACCAATATGGCCCCACTCTGTACAAAAGGTGAGTTACGTAGTTCAATACGCTACGT
GTGTAGTACAGCACGTGTGAATTTCGACTACCAAGACGTCACCCTGACCTGCTTGATGTGGCATTGCTTTGGGAGATCTTCCGATCCGGCCTACGTGATG
GAACAACTCGTGTCAGTATCAGCTGACGGGGGTATTCTACCTGAAGTTGCTGCGGGCGAAGACTGCCTAAGAGCAGGGACCGACGCTCTTTCCGGACAAA
TGGTGACTTCTTGGCCTATCCCCTTCTCTCTGGTGGTGGCGCAGACGATGCAGCAAGAGATGACTCCAAGAATCGAAGACCCTATTGAATAAGGGCGCCC
ACTGCACGACTTGCTGGTAGGCGAACCCCAAGCTCTGGAAGTTGCTGTCGCCCCGACTGCTTCGCTACCAACCCCAGCTACTGATCCGGCGGCAACGGTA
TGCACACAAGCTACTGAAACGAGCACGGCAGCCACCGCGCCAGCCAAGAGGGAGAAGCAGGACGAGGCCACGAGGCGAGGAGAAAACACCATGTACTGCC
ACGTAAACAGGACGTGGCTGAGCCTGCAGGTGTCACCGCCGAGCTCATGTCGCGCTCCTTTCGCCGCGGTGGGGCCCAGCACGCAAACGGCGACGACCAC
CTCGCTGCACAGTGGATCTTTGATCGCGGAACGTGGGACACGACGAAGACGAGTAAGGCGTTCGCATACATCACCAACACGGCCCGAGAAGACCGGAAGG
TGGCTCGGGTCTTGAGTGGTTAGGACTGTGACGCCTCTCCAACGGTCATC