Description :
From Genome Similarity Track
Location :
Scaffold_525:4211- 8324
Sequence
4113 bases(100 bases per row)
TAACCGAATGGCGACACGAACGCCGAGATGAGCTTGGCTCGCTTCGTCATCCTGATCGCCCAGAAGCCGCTGGCCATGTCCAGACTCATAAACCACATCG
CGCTCTCGAACCCGATTAGCAGGTCGTCAATGAGCGGGAGAGGATAGTTGGACAACTGGATGAACACGTCCACGATCCGGTAATCAATGCACATCCGGAT
GTCGACCTCGTTCTTCTTCAGTACCATCACGATCGGTGACGCCCAGGGTGACGTAGATGTCTCGATCAATCCAGTCTCCAACAACTTCTTCAGCAACTCG
TACACCTTCATCGCAAGGTGTGGCGCGACCGAGCGTGCCCTCTGTGTGACAGGCTTAGCGTCTCCCACATCCAGATCGCAAACGACTCCGCGAGCTGGGG
CAGGTGCCGCATTTCCATCACCTAAGAAGATACTTCGGTGGTACCTCAGGATGCCACGTAATCGGTGTTCGTCATCCGGCGTGCTCACGCCAGGTTCGCC
AACATCAGCCTTGTCAATGTCGCACTCGGGACTTAAATCCTGCACCTCCGGGAGGAGTGCGAGTTGGTCTCGCAGCTGGGAGAGCAGATCGCTCCCTTCA
TGAATGTACACGGCTGGTCAAAGTCCAACTCCTCCACACTTAGTCGCATCACCCGCTCGTACTCTTCTTTGAGTTTCTGCACCGGAGTGCAGGGCAGGAT
ACCGGATGGTAAGTCGGAGACATCCTCGTCGGTCACATCTGGTGCGTCTTCCGACACTTCGTTTTCATCCGGTGTAACCGCGTCAAAGAAGTCCTCGTCA
TCTCCATCCTGTGCAACATCCTCATCCGGTGCGACAGCCTCGAAAAACTCTTCGTCATCCGATTCGGTGTCACTGGTGAAGTCCTCAGCACCACCCGGAG
TCGCACTAGACTTCACAGTCGGATCAGTCTTTGGTTCCTTCGTCAGAGGTGTTATGCGCTTGAAGCTCGGTTTTTTCTCAACCAGGTCCTCCACGACCGG
ATCCTCATCGAGTTCCACGATCCTGTCCGACTCGGTCACTGGATTCTGCAACACCGAGGTGAAACACGTCACGTCCTTCTTCCAGCCCGGATGTAGCATC
AACTTGGTCGGCCATGAGTACTTCGCAGGCTCCACGGCGGGCGGTTCACGATCCCAGAGTGCTTGCAGCCGACGTTGTTCCCTCAAATTCGGTCGGTCCA
TCCGGTGCTCGCAATTCGGAACGGCTCAATCCAGAACGATCATCAACTTGGTCAGGCTGAATCAGGTCATCGTTGCTCAGAGAAATCATGCATTGTTGGT
TATCTTGGTGGCTGATCCTCAGCTCCGGTCCGACGTAGGCTAACACACACAATTCAGGGGCCTTCAGCCCGGCGCGTACTGGGTCCCCACCCAGCGGGCT
TAGTGGTTTAACGGCCCCCCTGAATTCGTCTTGTCATCCAATAGCTGATCCAGTAGGTTCTTCGGTATGTCCTTCAGTGCTCCATCTTGTGCCAGCTTCT
TCAGTGCTTCGATGGTCTTCATAAGTTCACACGGTCCTTCAGGAATCGTTCACAAATCCTGCACGGGTTGACCTTGCACATGCGCATCGGGTGTCCGCGT
CGGTGACAGCGATCACACACGATGTCTATCCAGCAATTCTCCTGTCGGTGTCCAGGCCTCTCGCACTTCTCACAGAATTCATTCCAATCAGGATTGCTTC
TTCTCGGCGACTGCGGCGCGGAGGGCTGACCGAATCGAGACGCCCCTGACTGTTGGCCAGGTGGCGGCGGTCTCCATCCTGAGCCCGTCATCACCCTGAA
CACTGCGTCACGTAGTACACCTTCATCCAGCACTGGCAGTACCAGGTCGGGATCCACCGGCCGTGTCTAGGCAGGAGGGACCGAGTCGTGCTTTGGTGCG
ACCTCGACTCGGTGTTCATCCACCTCGTCTTGGAAACGCACATGACGATCCTCTTCGTCTGATTCATCCTCGCTCTGAACGACGTAAGCGCGACCAGGAC
CCTTCGGTCTGAATCGCTCGCGTTCGCGGTCTCGATGCACGTTGCCCGCGCGGAAGTCGTGTGGTCTGGATGCCGAGTTCTCACGTCCGCTGTCCTGGTG
ATCGTCTTCGTATTGACGCAGAATGAACTCCAGGTCGTCGATGCTGTGCAGACGCTGGCTCTTCAGACTGGATCGAAGCTTCGACTCGGTCAGCTTCCGG
ATAAAACGCTTGATGTGCATCTCACGCGTCCTAGATGACTTCCTGAACTCCACATTCGCCTTGCAGGCGGCCGCATTCAGTCGGTAGAAGAAGTCAAGCG
CCGATTCAGTCCGTCCTTGCTCGATCGTGTAGTACCTCTCCGAGTTGGACATCCTGGACCGGCAGTACTTGCGCTTGAACGCATGGTATAGCTGGGTCCA
GTCGTCTCGTACATGCCTCGGCAATTGTGCACGCCAGTGGCGAGCGGATGTAGGAAGCTTCAGGCGTAACTCGTACACCTTCATGCTGTCCGTCCAACCA
CCCTGAACGGTCAAGGTGAGGAATCGCTCCCACCATCGTGTCCGCTCATGGTACGACGCCTTGTCGTCGAAGTCTTCGAGTGAGTTTGAGTTCTCGTACG
GCCGGAAGTTCATCACCGTCTTGCCGTCCTTCGTCGTCACCGACGTGGAGTGCGTGAGCACGTTCGCGAGCGAGTCGTCGGAGTCGCTTAAGCTGTAGCC
CTCGTCGTAGCCGTCATCAGAGCTCGAGTCCGGGTCGGATCCGGAGGGGTCACCACTTCCGCGACTTCGCCCGCCGGATGGACGCTTGCGCGGTCCTGAC
CTGGTGTCCTTCGCATTCTTGGCAGGCTCCTGCTTCACGGGCACCTTCTTCGCGTCCTTCGCGGGAGCATCCTGCTTGTCCTTCGCCAGCGCAGCTTGAA
CAGCGCGCGCCTTGGCTCCCGTGGTTGCTCTCGCCTTGAGAACGCTGTTGATAGTCGCCTGAAGTTGGGCTGCTAGAAGCTCGTCGGCACGCGGCGTCGC
AGACTGGATGGGCGCCTGACCAGACTGGATAGGCACACTGGATACTGGGTGCAATGTCTCACGCCCGGTCTCTGTCTTCACATGCGACACCGAATCAGAT
CCCGATGTTGCTTGAGCCACTTGATTTGCCTGGCGTGTTGCACGAAGGTTGTGTAACTGGTGGGCCTGAAACCGCTGAATGTTCCGGGAAGATTCTAGCT
CCCTCTCCCGCTCAGCTTCTATCTGGTGGACCTTCTCTTGGAATAAATCCAGTTGAGCGTTGAGTCCCCGTTGCACATCTTCGGCCCATCGGGTTCGTTC
GGCTTCGGCTTGCGCTTCCTGTTGTCTCCAGCGTTCGGCGAACTCGACGGCAGCGCGCTCGTGCTCCAGGCGTCCTGCCTCGGCGCGGGCGCTCTCGATG
GCAGCCGCCACTTCATGCGCCTGCATCGTCGACATTGGAGACGTGCTGGGCACGCTGGGAGGCTCCGGGACTGGGGCGTCCGGTCTCGATCCGGTCTGCA
CACTGCCTTGAGGGGTAGCGGTGCGTCCGGCGAGCTCTTGGATCGCCTGGAACGCGCTGTGAAGACCTTCATTCAGTCGGGCCGCGTTGGCAGCGGATGC
CTCCTGGTTCAGCTCCATCCTGGCCAGGGCTTCCTGCGTCTGGCGCATCGTGTTAAGCGCAACTTGGGACGCCCCGGACATCACGGACATCGCTGAGCGG
CTTGATCGACCGGATCGAGTCGACCTGCTCGACCGACTCGGTGCGCGCTTCGATCTCGAAGACCTTCGGCGGCGCATCCGGTCCTCGTCACTGGAGTCAG
ACTCACTTGGTGACGGGCTTCGCCGCTCGCGCCTGGACGTCGTTTGCCGACTGGATGAAGTTCTCGACCTTCGGTCACTCCGGACGGTGGTGTGATCGGA
CTCCGACATAACGACATCGTCCTGATCCACCGCCGTCGATGACCGAGGGAGTGCTGTCCGGGTGATCTCGACGACCCTCCGCCTGCACCAGACTGGATCG
CTCCTGCCTGCGCGGTCATCACCATGGGTCCGTACCCAACCGCGGACATGTGCCTCGCGGCATCGTGTCCGGACCACAGCGACGACGAAGACGAGCTGCC
TCTGGACGATCGA