Description :
From Genome Similarity Track
Location :
scaffold_5:4211- 7230
Transcript NameFunction/comments
g8100.t1hypothetical protein

Sequence
3019 bases(100 bases per row)
GCTGTCAAGGCCGTGGTGATGCCCAGAACGGCGCAGTTGGCCTACCACAGGAACGTCGCGGGCACTGGGCTGCAGTTGGAGCTGACGCTGGCGATGATGG
CCGAACAGATCCCGCGGCGATGGCCGTGGGTGCAACGCTGCCACTGTGTTATTTGGGACGAGAAACACTTGTTGATAATGCTAAAGACATTGACCATAGT
TTATTCGATATATATTCGGTCATGTTGCTCTGAAGGCATTAGCATACTTTAATCAAGATAAATACCCTCTTCTTTGCCTACAGAATGCGAATCATTGGAA
TATCTGTCGCGCAACTCTGCTGTCTTGACTCGCTGAATCTTCGCTGAGCAACTCTGCACAATCACTACTGAAAAGTAGGTCGGTTTCGTCGACGGAGAGT
ACAGAACTGTCGCTGCTTTCGGGGATAGGGAGAGCTTTATCGACGGGTCTCGCGGCGCTACTTGCCTTCAACTTAGCCAGATGCGATGACCTGTTGACAT
TTCCATTGTCACTGAAGAGTCCATTTGGGAGATAGAATCTGTGAAACTTATCCCAACAAGTCCAAGTGCTCTGTGGGCACGTGTACGGACTCTCGATGTA
TCCATGCACAGTGCTACAAAGACAAACAGTGTGCGTGAGGCAATAATCCGTCACCTCTGTAGGATATCTGCCCTCGTAGCGACACACAATGCACTGCCGA
CGTTTCCGCCCACTGTCCTTGAACATTTGTTTCGAAGGCATAGACTGACATCGCTTCAGGGCGCTGTGCGGGTTTGGCGAAGTGTACACTTTAGGAGTTA
TACCAGTTGCATCCACTGCTGCGATTTCATCAGCAACACCGCTTCCAAACGCCATTTGACCATCGCTCGGGGCTTCTTGCCACCTGCCAGAAATTAGCTC
AGATACTAATTCAGTGACAAACGTCCTGTGGGGATCTCGATCTCTGGAAGTGTCGATTGCCATCCGTCGAGTCAGGTACGCGTTGGACCGTGCAATATCC
ACTATTGCCAAAGCCAATTTTTATGCCATTTTTTGAACGAATGACCATCAGCTAGTGAAAATCTAGCTCGTATCTGATCCAAACGATCAACACCTTGCAT
GCGTCGATTGTATTGCAGGATACAGCTCGGAGCAGGAAACTCATGAGTATTTTTACCAACCCGCCGCGTGACTGTCGCGGCAGTAGATGCATCAGCATTG
GTAACCATCATCACGGTATTGCCATCGCACCACGACGCACCGAGCAAGTTGTGCTCCAGGGAGACAGACTGCTGATAGTCACCCCTTGTTGAGTGCTCCT
TCTGGAGAATAGTGTGCTTCGGATAGTGCTTACTCCTTCCCCGAACAGTTCCCCGCCCATACAACCCCTTCAAACGCAAATCCAACAGCAACTGGACGCT
TGTGTAATAGTTGTCCATATTGATGATTCGTCGAGAGTAAAAGTAGGGCCTCACGACCTCTAGAACATGCTTACGCACTTGTTTGACATCCTCGAGCTCC
TCACGAAGCTGCTGCACCTCTTCTAGGCTCACCACGTTTTGCAGGCGGTCCGCGATATCACTATTATTGCAGTGGAGGCGATAGTTCAAAGCGATCCACG
TGATCGAGCAGCACAGCACGTACATACGAAAATGATACTTGCCGCCAGGGTTTTGGGGATTGAACACGATAAGATGTCGTCCATGGCGGGACCGGCATGC
GATACTCGCTTCGTCAAGAGCCAAGTACGGCCAGGCTCAACATAGCGACCACCAGTGCATTTGAGCAAATTCAATAGGGGCCTAATTCGGGCTGCTGGGT
CTCGTTCCACAGCCGATCCCGGATCAGCGCGAAAGCTCAAACAGCGGCGAAGCAACTTGAATCTATTTAGACTCATCACATTGTCCAAGCTGGTAGATGC
ACCACCAAAAATCGCATCTTCAGTCTGTGACCCCCAGTAGTTAGAGTACTCCCCCTTGTCAGTGAGGGTCAGATAAAGCATGATGCCGAGGAAGATCATC
AGCTCTTCCATTGTAAACGGCGTGGTGACTCGAACATTCTTGAGGGCTGCATATCGATTCGTCTCGAGAACCACTTGTTTCCAGAAGTAAATTGGAATGT
AAGCGAAGAAGCTCGAAGAGGCTGAGTGTGCAAACAGGTGACTGTACTCGGGTAGTAAGCGTGTACTAGTGCTCTCGTCCGTGTGTTCATACAGATCCGT
GGGGCCATCCATATCCACATCTGGCTGAAACCGCATACTGTTCACCGCTTCCACCTCCGCAAGGCTCACGGGCAAAAATCGCTCTGGATCGTACATTTCC
ATACCGTCGTCGTCTGACGCGACTTCAAGTTCATCGAGCGGTTCCTCCATCTGCAGCTCCCCTTCCACCACTGTATCAGTCAATTCACGCCACGCCGGCT
TGTTGGGTGAGCGCGCGAGAGCCTGGTAGTTCTCGATCCCGCGCTGAATTACTGCCACACTCAGAGTTTCAACTGCATTCTGGAACTGCGTATCTAGCCA
AATTACTTGTAGTACCCCTCCCTTCTTCGTCTTTTTGACCTGACGACACACACGGCCGACAATAAAGGCTGTGCCCACGCATCTATACATATTTTCCTTC
ATCCACAATTCCTTTGACGGTGAAAATGCCACCAGCTTCTTTAGGAATAGATGCTCCATCAAAGGGGCAGGAGGAGTACGTCTCTGCGGCGTACTGCGCG
TGGGGACACTCGTTGGGGTTTCTAGGTTGGGTTCAATCACCAAGCTCGCTTGCCGTCTTGAAGTCTCCGCCCCGGTAGCTGCGGTAGCCGCCTCTTCCAT
CACGCTCCTGACAATTCGATCTCCGCGACCGCTTCCGCGTCCGCGGCCAAGACCACTACCGCGCCGACGCCCACACCCACGAACTCGAACACTACCGCGG
GCACTACCGACAGGTCCCGCTGCCACAACGCCGCCACCATCGTCGCAAAGCCCTTGCGCGTCAACAACTGCTTGCTGCCATCCGGTTGATGCCGCGACAA
CACCATCGTTGCCAGGCTC