Description :
From Genome Similarity Track
Location :
contig_1:421078- 422752
Transcript NameFunction/comments
g157.t1CCA17008.1 PREDICTED: hypothetical protein [Albugo laibachii Nc14

Sequence
1674 bases(100 bases per row)
AGCGTGTGCAGAGAGGCGAGTCTGCTGCCAGTGTAGCACGTACGTCGTCTGTGCCCCTGCGCACCCTCTTCAAGAAGGCGAAAGATCTGCGCGAGAATCG
AACGCTCGCAGGCAAACGACGCGGCACGAAACCCGCTATTCCGCTGGCGCTAGAGCAAGATCTGGAGGACTGGGTTGCCGCCATGCAGCGCGTTGGGCTT
CCCGTTGGTCCGTATGCCATCCTCGCCAAGGCAAACGAGATCTACGCGAGCCTAAACTGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCA
ACATGCACTAAGGCACACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAACAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGA
GAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAG
TTCTCATTTACCACCAAAGCTTTCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCT
TCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACATAAACCCTATTCTCACACGCAGCGAGCCACTCAAGAAGCT
GACCACCGGCTGGTATCGGCGGTTTCTTAAGCGGCATCCTATCCTCGCGCCCCGTGTTGCGCAGAAGATCGCACGCGTGCGCAACAGCGTGGAGGGGGAA
GCTGTGCTGAGACTCTTCTACACGATGGCGAAGCTGATTATCGAGAAACGGATTGAGAGCCTCGAGCAAGTTTTCAACGTCGATGAAACGTCCTTCATGC
CAAAGACTACTGCAGGCAAGGTGGTCGCTGTTAAGGGCTCCACAAATGTCTGGACACAAGAAGCTAAGGCCTCGTTCCACATGACGGTTGTCGCTGCAGT
GAGCGCAGCTGGCGTCGCTATACCCCCGCTCATCATTCTCCCCGGAAAGCGGATCAGAAAAGAAGAGATTGCCGCCATTAGCATTCCGGACGCATGCACT
TCAGGAGCTCCCAAGGGATTCATCAACGCAGGGTTGTTCAAGCTTTGGCTGGACTTCTTTGACGCCCAACTCGAGAAGCACAAGGTGAAGCGCCTAGTTG
TGCTCGTTTTGGACAACAGCTCTACCCATGTCGACATTGGTACGTCCCGTTTGGTGATTTCACGTATTGACTGCCTCTCAAATCGGATATACGCGATTCA
TAACGTTTTTATCGGGTTATGTATATTTAGAGGATATTACAGCTTGCTGCTCTCGGGGCATGTTGCCTGTTCGCCTGCCTCCGAATTCCACTCACTTGTT
CCAGCCTTTGGACGTCGCAGTATTCAAGCCGTTCAAGAGCGTAGTAAAGGCGGACCTGCAGGCGAAGTTGTTGTCCAGCGCAGACGGAAACGTGTCCAAG
AAGGAGGCTATCGATATCGCGTGCCGTGCGTACCGCTCCGCCCTCATGGAGCACCCCCAAAACGCTGTCAACGGATTCAAGGGCACTGAAATCTATCCGC
CGTCGCTGGTTAACATGCAGCGTCGTCTTCGTGCGTTTAAAAGTGGTGGGGCGAAGGGAACGACTGGGCAAATC