Description :
From Genome Similarity Track
Location :
Scaffold_1:421072- 426840
Transcript NameFunction/comments
g139.t1RAW31858.1 Dynein alpha chain, flagellar outer arm [Phytophthora cactorum

Sequence
5768 bases(100 bases per row)
ATCAGGAAGAACAGTAACGAGCCTCGCGCGGCGATGCTGCGGTACTTTTCACTCGTAATGTTCACGGACTCTTGCGTCTTCTTAGCAGCCTCCATATTGT
TCTGGGTACGTTGGGCTTTGTGTTTTGTGTCGCTCAGAATCTGGATAAGCGGCTGGTTGTTCGTGATATCATCGTCTGCACTTGCCAAGTAGAACAGGAT
ATCATCCTCTAGCTTCTTGAGCTCGATCTTGCCGTTATTCTGTTCCTGGATCAACTTCTCGCGTTTAATGGCCAGATCTTGGCGTTCCTTGGACACAACA
AGGTTCAGCAACTGGTCTTCAAGGCCAAGCATCGTGACAGTAAAGTTAACAATGGTGCATTCTGCTTGAATCTCAGGCGGGTAGTGCGGATTGCCCAGCT
TTGTGTGCAGGTACAAGTGGAAGTTGTCGTTGTACGGGACGGAAGCATCACCGATTTGGATCTCGTACCGGGCGCCACGACGTGAAGTTGAGCGCTGAAT
GACAGGAGCCAAGATGGGGTCAATCTTCTCGCCCAAGTTCTCGATGAGGAAGGCACCATCCGTGCCAATTGCCGTTTTGAGACGCTCAATCCACATTTTC
TGACCAACTCGCACAATGATAAGGTTGTTGTGCGCTTCCATTTCACGAATCCATGCAATAGCTTGCAACTGCGGGTCGACGATAAGTGGTCTTCGTCCCA
TAGACACTGTGGTCACCACAATAGCACCATTTTCCGTTGACACTCGATCTGACGGAAGCTTCTGAGTGTTCCACTCGGCGATCTGCGCATCGTTTGTCAG
AATGAGTAGTGGGTTGGCTTCTTCCGACATAGCAATGCTTTCACCTCCGGCTGCAGTGCGCAGGTAAGGCACCCAATGCTTGTTAATGAGTTCATCTCGG
AAGGGCTTCGTGAACGGGCCAATGTATGAGATGAAAGCAGATGCAAGCAGCACATCGCCCACCAGTAGATCCTTCTCCTTTTGAAGTTGCAGCACATTGA
TCCCCCAACGTACGTTTTCACTTGAAAGATCATTAGTCAGGGTGCCTGCGAGCTTCATCTTGCGATTTCCGGTCTCAACAGCATTAATTGCGTCTTCTTT
CTCCTTCTCGGCTGCAGCTGCCTCGGCCAGCAGCTTGTCTAGCTTTGCCTGCAGATCAGCCACAAGCTCGGTCACTTCGGTTAGACGAGCATTTGCAGCC
TCAAGCTCAAGGTTGGCAGCGGCCAAAGCTTGTCGCTTCGGCTCGACCGTGATGACGATATCGTAGTACATGACGATGTTGATGACCCATGAACACAAAC
CGGCAGCAGCCTTGTTCTTTGTGAGAATCGTATCGTAGTTGAAGTGTTCCATCTCTAAGAACACGCGCACCTCTTTCCAGTTCGTGAGAGGTACCTTGCC
GTCGTCTACGACCTGCTTGAAGCCCACCAAATAGTCAATGTACTCAGGGATGTTACCCAGAAGCTGCTTCTTGGCGGTGTCCCATTTGACATCCTTCACC
TTACCAGTCTTGGTAACTTGAACGTTCGGGTGGACACCAGCCAGCAGAACCATGGTAGCTGAAAAGACATCGTCTACACCAGCAGGAGGCTTCGACATTG
TTTTACACTCGCCCAAATCCTTCTTGTTCAACGAGTCAAGTGCTGCCATAGCCTGTTCTACAGCAGGTTCAGCTTTTGCAAGATCCTCCTGCGTTGAACG
TTGTTTCTCTGTAACCTCAGTTTGGATAACGGCACACTTTGCAGCTTCGTCACCAGCCTTTTTACTTTCAGTTTCCACATTGGCCTTCTCTTTGTTCACA
GCCTCAGCAATACCAGACGCTACAGCTTTCTTGTCTTCAGCAGCCTCAAGGATAACCTTAAGCTCCACCTCAAGTCTCGACACGGTATCACCAGTTTCTT
TAAGCTTTTGAAGTCCTTTCTCCAATCGATCGATGGCTGCAGCGTACTCCTCCACTTTCTTGCGCAAAATCTTTTTGTACAGCTGAAGCAACTCCAGGTA
CGACTTGGGTGTTGTGTACACGTGGCGGCGCTCCACCTGGAAGAACCGCTCGGCGCAGAGATTCACCGACTGAAATGAGAACGGCATAAATGTTTCAATA
CCCGCGCGCGACTCATCTGACCCAAGCAGATCTCCAATCTCCTTCAGTTTCTCGCGACCGACAGAAAGTAAAGCTTCCTTAGGCCATGGCTGGAACCAAT
CAATGACTGTGCAATTCACCAGTGCGGGGAACTTACGTGCACGGTTTCGGAAATCATCACCCACAGGCGAAAAACATAGGCACAAGTGGAGTCGCTTACG
GATTTCTGCTTGGAAGAACTTGACAACTTCCTTGCGGTCCTTCGTACCAGCTACAGGAGACAGCAAGTTGACGATATTGTCCATATCCTCCATCGCGAAC
AGATCTGGAATTTCTCCCGACGCCAGCAGATCGTTCAAGTAGATGAGGAACTTTTCGTTCGTAATTTGAGAATCAGTGAGCATGAATACGACACCTCCAT
CTTCTTCATTACGAGACAGCATTTCCACTACCGCCATGTGCATTTTGCGCAAATCTTCCTTGAATTCATTTTCGCCGTACTTTGAACTGATCGTGATCTG
ACGAACAGTACAGCCGCAGATATGCGAGGCTAAGCGTGCGAGCGAGCGCTTGCCACTACCTCCCACACCTACCAGTAGTGCATGCCCGCTTTCGTTTCGT
AAGATACGAACAATGCGAGCCACGTGCTTCACAGCATCATCGAACAGGTCCAGCTGCATAGCCGTATTGTTCTCGTTGTTGTTGTATTCGCGCAGCTGGA
TTTGCAGGTTCATCTTGAGATCGTCCAGGTTCGTCCCCATAATTTGGTCGTACTCGCTATCGCCATCTTTAGTGAAGTGGCAAAAGATGAGGGGCCATGA
GTTCTCGGCAGCGTAGTATCGGCTTGTGTTGCACGACGCGAATGACTTTTTCACTTGCATCTGTACGAGCTGGTTGTATTTTTCGATGTCGGCTTTGCAT
ACAAGTCGGTCGCCGTATACGCGTTCACTTTCGTGCAGCCACAGCAAAACGAACTTCTCCTGGCTGTTAAAACGATCCTTTTTTGATGCGATAAGCCCTT
GGAATACATTGGACAAGTGGCGCACATTGAACTCGTAGTGAAAATTGGCTGCTGTTTTGCGGAACGTGCTCACAACGCTGGCATGCAAACTCAATGCAGC
CTTGATAAGCGCGTTAGAGAACTGGGAGTTACTCAGCTCATCAACGAAGCCTGATAGATGCCCACCCAGGAACGTTTCATAGATCGTCACCAGACTTGGT
GCTTCAGGCATACCCATAGCAAATGTACAGAAGTGGCGCTGGAGTCGAGGGTCAACCAGGAATGAACCTGCTGTAGGGTTCATGCCGGAGACCATTTGCG
TATTCAGAATATTTTGCGTCTGAAGTTTTACGCGGTCGAACCAATGTCTGTACTCCATCACTTGTCGCAGCAGAGAAATAGCACTTTGTGTGTTATATGG
GTCTACCTCTGGCAGATTAAGATCATCCATGAAGTAGATGAGTCGTGCTTTGCCGGGTGGACCAAGATTGATACCGGTTTTACGCTCCAGTTGTCCAAAC
ATGGTTTGCTGCAAGATGGAACTCGTGGTGTAGAAGTTGAAATTGATCGTACAGTAGCGGAACGCAGCCGTTGCCTCGTCCTTGCTGAGCTTTTTTAGCA
TGCCCATGATATTCTGCGTCTTGCCCGTACCTGCAGGCCCGCACACCATAACCGGCACGCTCTTTGAGATAAGGTTCTCGAGCCAAAATGCAATGGATGC
AGTTTCGGTGGTGGGTACTGTGATTTGGTTGATTGGGCTTGGGGATACATACGTCTCCGTGTAGAAGTACGGACTCTTGGACCACGAATTAAACTTCGAA
GTCTCCGGGTCAAGCCAGAAATCAAATACCGTGTTGCTGGCCGATGCCACCAACTTAACGTCCTTCCATTGGTTTTTCCACCAGTTGCTAAACTCGACTG
AGTAGTCCGTGCCATCGTCACTCATGGTGAGGATGGATCCAAACGACCACACACAGCAGAACACGAACGTGTTTTGCATCACTGTGTAATCTTCCAACAC
TTGGGGTGTCAGCAGACAATCGATCATGTTCAATAAGTTCGTCACGAGCGTCGTTTCTTCTACAGGGACCACGGGGACGAGTTTCTTTCGGAAGAACCGA
AGGGTCGTTTCGATGTATTGATCAAAAAGCGCTTGGAATTTGGAGCGCGTGTCTGGGGTGAACATCATATTTCTGAGGCGGTGATCCACAGGCTGCTGAC
AGTGTCGATCAAGCCAACTGTCAATCAGGCAGCGCCACTGGTAGCCCTCTGATGTTGAAATGTAGAGAATGCCGGCACGAGATACGGTAGCCGGCGTAGC
GTAGACTAGATCACGGATCTCGAAGATCATACGCATGTGAACTTTCAGTGGAATACGCTCGTTCGAGGCCAACGTAAGCATTCTGTTATCGTCCATGACT
GAGTTCATCGACTCAATCCAGTTAGCATCAAGATCTCCGTCAAGAATAATCCACTTGGGGTTGTTGTCTTCATCACCATTATCACGGCGACGAGAGCCCA
GATCTCGCATAATTCGAGACAGCAAGCCATCTTTCCATTCGCGTGTCTTCAGCACGATATACCCGTAAAGCTCGTTCGTGCTCACCGATTTTGGGTTTAG
GTCTTGGACTTCCATAGGAGTGCCCATGATCTCGCGAGCCTTCTTCAGCGTCTTCCAAGTCTCTGTTTTACCTGAAGCTGGTGGCCCCATCACGAAGACA
CAATGCCGAATCGCCAACAATTCTGACAGCTGCACAACCTTCAGCATAAACTCTGGGCGAGGTGTATTACCGATTGCTTCTGAAGCGCCCTGTACCATGG
ATTCAAGCTCCATATCACGCTTACGCGGAGGGTCGTTCCGAACGTCCACATTCGGACTATCACGCGGGAACAGATCTCCGAGAAGACCGAAGAAAACAAC
CATATCCTCAGCAACGATTTTAGGGATGTTGAAGTCTCGCAGCGCGCGCATGAGCAGGTCCGTTTCAGGAATGTCTGGTTCTGCACGTTTAAATGCGCCG
GCAACGCATAGCACACTCTTCACAGCTCGAAGGCCCCAATCGTAGTGCAGCTGCTTGGACAAAAGTTGCCCTAGCAATGAATACAAACCGTAAAACTTTG
ATGCCAAGATCTTGGCCTGGGTGAACCCTTCTGCCATAAGCATGTTTTCACAGATCAACACCAGATCGGGCACCATGACAGTCATCGGGCGGAACAACGC
TTTCAGACCTTCGGGCAGCTCAGAGCGTCCTAAGTAGCCTGGATTCATAGTAATGAATGCACCAACTGTTGGATCAAGCATCACCTCGTCATTCTCAAGG
ATAAATCTCTCGTCGTCAGCTTTACACGCGTCGCATACAGCCTTAAATTGGACAGAGCACACCGACAACACTTCTGGCACGAGACGATTGAACTCGTCGA
AGCAGCCCCACGAACCCGACGATGCAAGACCTTTGAAAATGTTTCCCAAACTCTTAAAGTCCATTTCGGGGGAACAATTGAACACATAACACACTTTCCC
CAGTGCGTTAGCCAAATCTTTTGTCGTCTCCGTCTTACCCGTACCAGCTGGACCAGCAGGGGCACATCCCATTTGCAGGTTCAGTGCTTGTGTTGCCGTC
ACGTAAATTCTATCGGTCAGTGGGGTAATCACCAGTCGGGGACCATTTCCAAGATATTCGTAGTCGTA