Description :
From Genome Similarity Track
Location :
contig_1:421061- 422735
Transcript NameFunction/comments
g133.t1hypothetical protein

Sequence
1674 bases(100 bases per row)
TGGCTGGCTCTCAGTTTGTTGCAAACGCAAAGCGGCGATGGTGGTGCGCCGGGGGGCAGTACACACTTGAAGACCTCGCAGAAGCCCTTCAGCGTGTGCA
GAGAGGCGAGTCTGCTGCCAGTGTAGCACGTACGTCGTCTGTGCCCCTGCGCACCCTCTTCAAGAAGGCGAAAGATCTGCGCGAGAATCGAACGCTCGCA
GGCAAACGACGCGGCACGAAACCCGCTATTCCGCTGGCGCTAGAGCAAGATCTGGAGGACTGGGTTGCCGCCATGCAGCGCGTTGGGCTTCCCGTTGGTC
CGTATGCCATCCTCGCCAAGGCAAACGAGATCTACGCGAGCCTAAACTGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTA
AGGCACACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAACAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCA
ATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTA
CCACCAAAGCTTTCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCTCCTACA
CGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACATAAACCCTATTCTCACACGCAGCGAGCCACTCAAGAAGCTGACCACCGGC
TGGTATCGGCGGTTTCTTAAGCGGCATCCTATCCTCGCGCCCCGTGTTGCGCAGAAGATCGCACGCGTGCGCAACAGCGTGGAGGGGGAAGCTGTGCTGA
GACTCTTCTACACGATGGCGAAGCTGATTATCGAGAAACGGATTGAGAGCCTCGAGCAAGTTTTCAACGTCGATGAAACGTCCTTCATGCCAAAGACTAC
TGCAGGCAAGGTGGTCGCTGTTAAGGGCTCCACAAATGTCTGGACACAAGAAGCTAAGGCCTCGTTCCACATGACGGTTGTCGCTGCAGTGAGCGCAGCT
GGCGTCGCTATACCCCCGCTCATCATTCTCCCCGGAAAGCGGATCAGAAAAGAAGAGATTGCCGCCATTAGCATTCCGGACGCATGCATTTCAGGAGCTC
CCAAGGGATTCATCAACGCAGGGTTGTTCAAGCTTTGGCTGGACTTCTTTGACGCCCAACTCGAGAAGCACAAGGTGAAGCGCCCAGTTGTGCTCGTTTT
GGACAACAGCTCTACCCATGTCGACATTGGTACGTCCCGTTTGGTGATTTCCTATATTGGCTGCCTCTCAAATCGGATATACGCGATTCATAACGTTTTT
ATCGGGTTATGTGTATTTAGAGGATATTTCAGCTTGCTGCTCTCGGGGCATTTTGCCTGTTCGCCTGCCTCCGAATTCCACTCACTTGTTCCAGCCTTTG
GACGTCGCAGTATTCAAGCCGTTCAAGAGCGTAGTAAAGGCGGACCTGCAGGCGAAGTTGTTGTCCAGCGCAGACGGAAACGTGTCCAAGAAGGAGGCTA
TCGCTATCGCTGCCGTGCGTACCGCTCCGCCCTCATGGAGCATCCCCAAAACGCTGTCAACGGATTCAAGGGCA