Description :
From Genome Similarity Track
Location :
Scaffold_39:421024- 423194
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011929Similar to sptB: Serine palmitoyltransferase 2 (Dictyostelium discoideum)

Sequence
2170 bases(100 bases per row)
ATCGGCGCGAGTGTGTGCAGCCGAGACGCAAAAGCGCACGCGCGCCAGCAGCAGCGGCGTCGCGGGGAATCCGACAGTCACGACGGCCAGGTTGCGCTTC
AAGCATTCGCGCGAGTACTCGCCGACTTTCGACATGTGGAACAGCATCACGGGGATCACCGGCGAGTCAAAGTTGCCCAGTGTCAGCACGCCCATTTCGC
GCAGCTTCTGGCGAAAGTAGTTGCTGTTTTCGCGCAGCGCCGTGAGCTTCTTCTTGCCAATGTCAGTGCCGTCCTTGCCCGAGATGATGTTGAACGCCGT
CAGCGTCTGCTGTGCGATCACGGGGGACAATGCGGTCGCGTAAATGGCGCCAGCACTCGAATTGCGGATGCAATCAATGATCTCCTGCGACGCCGCAATG
TAGCCACCCATGCCGCCGAAACTCTTCGTGAACGTGCCCATCAAGATATCGATCTCATCAGGGCTCACGCCGCTGTATTCGCAAACGCCGCGGCCTGTCT
TGCCCAATGCGCCAATGCTGTGCGCTTCGTCCACGTAGATGTACGCTTTGTACTTCTTCACGACGTCGACAATCGCACGCAAGTCGACGATCTCGCCTTC
CATGGAGTAAATGCCCTCAACCATGACCATGACCTTCTTCCAGGCACGACCGCTGCGTGGCTGACCGGCGGCAATCTTTTGGCGCAGCACTTGCTCCAAG
TGCTTGGCATCGTTGTGGCGGAAAACGCTGACCGTGGCACCCGACGCACGTGCACCGTTGACGATCGACGTGTGGTTGAGCGCGTCACTGATGATAAGAG
TGCCCTTACCCATCAGTGCTGGGATCGACGTCGCGTTCGTCGCGTACCCCATGTTGTACACGATGGCAGCAGGCTTGCCCACGAACTCGGCGACCGTGGT
TTCGAGCTCCACGTGCACCAACGACGTGCCAAACTCCATCGGTGGCGTCGTCGAGGCCAAACCGAACTGCTGCACCACAGGGAACACCTTCTTGCTGCAC
GTGTTCATCCAGTCATCAGCAAAGCCCAAGTAGTTGTACGAGCCGAGGTTCAGGCACCGCTGGATGCACCCTTCCTTGTTGTGCAGCGTCTTGTTCTCAT
CCAGCGAGTAGCGCTCAATGAGATCAATGTGGGCGCCTATCAGTGCAAAACAAGATGACGTACCAGTCAGTATACAAAGCGTTTGCTGCCTCCCATTGAT
GCATCGACACGCACGCACAGCCGCCAGTAGCCAATGCACATTTCCCACAGTCTCACTTACCAGGGGCGCCTGCCACAGGGCGGTTGAACACGTCCTGCAA
GCGGTGGTAGATGCGCTTGGTGTAAAAGTTCTCAAACGCGACGAGCAGCGGCGCGTACCCGGGCCGCGACGTGGACTTGTAGCGCGAGCCGCCGAAGATG
CGGCCGGCGTGCTCACGCACGTGACCGAACGTGATCAGCACGGCATACTGGATGTAGCAGAGGATGGCCGCAACGATCGGCACGCTCTCGGCCGTCATGC
TGGACTCGCTCAAGGGGGGCGGAGGGATGCAACGGGGGGGGGGGGGAAAGAGAAACTGGCGCGGGGGCTGCTGTGCGGATGGTCGCCGACAAAACGCTGA
ATGACCGACGGTTGGGGGATCGCGCCACTCTATCAGGATTGGCGCCAGCCTCATCGTGTCTGGTAGGGGGGCCGCTCGATTACGCCACATGGTGAAGGTG
GATGCACTCAATCCAGTACGACTAATGGCTAGATTAGTCTAAACAAGTACATTTGGTAAATGTAACAGTCAGTACATTTGATCAAGGGTCTCTATTGGAT
ATCTGTTTGTAAAAAAATATTGAACATGTTAGGATTGATGGGTGGACTACTGATATATAGTGATTTAATGTGATAGAGACGCGCACGCGTGAGGTTTTTT
TTGAGGAGGGACGGCCGGTTCCCTATTTTTCGCCTGTTGTTTTTCTCTGGTGAACCAGTTCGTGGTGGTGATGGGGTCACCCGAGACATGCGCGACCACT
AGTCCCTCTGAACAACGCCACATGTGCTTACAGTACATAATACATAGTAGATATAGAGAATAATATATCTACAGGAAAAGCTATCACTGAACCTCCGTCA
TGTAAAGAGCGGCGAAAACAATTAGAAATTGGAGACGCTCAGCGAGTGCAAATCGAGCGTAACGGTGATT