Description :
From Genome Similarity Track
Location :
Scaffold_40:421- 25966
Transcript NameFunction/comments
Phyta_totarag1894hypothetical protein PHYSODRAFT_248374
Phyta_totarag1895hypothetical protein
Phyta_totarag1896hypothetical protein PITG_03352
Phyta_totarag1897DNA mismatch repair protein Msh6, putative
Phyta_totarag1898conserved hypothetical protein
Phyta_totarag1899hypothetical protein
Phyta_totarag1900RNA polymerase-associated protein CTR9
Phyta_totarag1901hypothetical protein PHYSODRAFT_284208
Phyta_totarag1902cleavage induced hypothetical protein

Sequence
25545 bases(100 bases per row)
CGAGCTCGCACTGCGAGTCGCAGCCCCACCGAAGGCCTTGTTGCTGAATGTACactgtgtacatgtacaatacatgtacttgagGAACGCACGTTGGATG
AGGTTGAGTCAGCGCTCTGCTGCAGAGTCTGCACGGGATCAGTTGATGCGGACTGAGCTGCACGGTGCAGCCTGCACCACCTGTCTATGACCTGCACTTA
CTATGCAGTTAACGCACCCGAATTGAGTTTGTGCTCGTAATACATGCATTATCGAATTTGTAAGGTTCTTCAGAAGCGGCACAATACGGTCACGTTAGCA
ATGCTAATACACCCGTTCAGTCTGTAGTCgcaacgccaccaacttTGACGCCAGCTTCATAAAACGAAAAACTGCGCGAAGGGAGCAGCACATctcgaca
gcgaagaagtgCGAACATGGCGCGCTCCATTCCGAAGCCCAACCCAGTCCTGGACAGCCTGCTGGTGATCCTTCTCGTGTGCGAGCTGGGGATCATCACG
CACACGCTGTGGGATGACAAGCAAATGCTCTATATCCTCGTGGCCATGGTCTTCGTGGTAGCGCTGGCCGTCAAGCTCACCAAGACCTCGTTCGCCATCG
GAGGCGGATGGTTCTCGCGCacgttcctgcagcacctcgggGACCcgctcaagaaggcggtgaCCATGAAGAAGTGGTGCGACCAGTCATGGCAGCTCGT
CATTCACGTGTCCATGACGATCTTCGAGCTGTATGTGCTGCGCGATGAGACGTGGTGGCAAGACACGACGACACGTAAGGACCTTACCCTGTTTGACTTG
TGCATGGGGCCCATCTGCATGAGGCTAAGACTGACTGACGGAACCTCTTGACCCTTTCGCGTCTATGATACACATGCAGTGTGGAACCAGGGAACGGACA
CGGGCGTGTTCCCGACGCAGAAGttcagcaccaagctgcttTACATCACACAACTGGTGAGATCCGTGGTGTAAGCCCACTTGCTGATGGAGTTCCTAAC
GTGGTGGATTCTGGTTGACTCATTTTTTATTAGGCCATTTGGATTTTCACCGCGTTCTCGTGCAAGTTCCTGGAGGAGATCCGCAAGGATTATTTGGTCA
TGATGACGCACCACGTTGTCACGATCGCGCTGGTCACGTGGTCGTACGCGGTGGGCTTTCTGCCCGTGGGTgtggtcgtgctgcttcttcatgacATGAC
TGACATCCCTCTCGACATGCTGAAGATGGCCAACTACCTCAAGATGGAGGGCGTCCCGGGTCTGTTTACGAGCGAGATCCTGTTCGTTACCACGATCGTG
CTGTGGTTCTACTACCGTATCTACCAGTACCCAACCAAGCTGCTCTACACGACCATGGTGGAGAACCGCGAGGCCAGCATGACAATGGCTGACGCACACG
ACTTCACACAGCTCTTTCCCCACCCAGGACCCCCGTCGTGGCTGCTCTTTAACGTCCTGCTCACGACTCTATACTGCTTGCACATTTGGTGGGGTCTCCT
GCTCGTGCGGGTACTTATTGGCGTGGTAACCAAGGGCGCCCACGATACGGCCAAAGAGGAGTACGAAGGCACATCGTCCGACTCCGACAACGAGAGCAAG
GACGACTAGAAGGTAAACGTGCTTGTGCGTGGAAGGACTAGAGGGTCGAGAAAGACTGCAACTTGATTAGGAGAGTAAGAGAGAGAATGAACGAAAGTGT
GCAGGTTAGAGTTGCAGAGGTTCGTCTCATCTTGACAGCAAGCCTCCGCAACATCAGCGTTTGGCCAAAGTCGAAGTCAAAACAACAATCGCGTTGCAGG
GTTCATGAACGAGAGACGAAAACACCAAGGTATCCTCCAGAGGTTGTAGAGTTAAAAGAGTTCTACAGTAGTATGCCGTTGATCAGTAAGGTAACGAAGA
ATTGCAAACTCACCGGATTCGCCGCTCGAAATTGTTCTGCTGTGCTGTTTTCTGTTGGATTAATACCAGTTGAGAGTCACCACTTTCTCAAAACCTTTTA
GACAAAAGGTATTCGCCTTGCGGACTGAGTTCTTGTCTCTTACCTTTCGTGGAGAAACATTCGTCGTCACCACGGCGATCTTCACGCGAATAATAGCCGC
CAGTAGCCCAGTACCCGGTGCCTTTGGGCTTGGTTCATCTGCGTCGGACAGCGTTTTTCTCACAGCGTTCGAGGGATGGAGATGTCAGAGTTATTTCCGA
AGTATTCGGTGGCTTTCTCCTCGTGGGGTAAAAGGCGCGCCTCGCTGTCGGAGTCGGTCACGATTTTCTGGGGAACCAAGCGCGAGATACAGTGTGCGGA
CGGCTGCATCGTGCAGACACGCACTGTGTTCTCTCGTCATTCGCGGTGTGTGCATACATGTAAAGGGAACTTCAAATCAACCAGTACTATTCACATGTAC
TGAATTAACGACGCAATGAACTGACGAGATTCAGCCAATCGACAGACCATATTTTGACAACCAGTGCGTGGCGCGGGATAAAAGCAAGCAGGCCATCAGC
ATGATGGAGGCGTTGGGCGAGGCGCCACCGGCGTCAATGGAGTCGCTGGTCACGGAGGATTCCATCGTGAAGGCTCTGCAAGAGATGCTCCCATCGATGA
ACGCTGACACAGCGACGCTGAAGGTGgtgatgcagaagctggcggtTCACTTCGGCATGGAGTTTGTGGATTTTAAAGCGCAGTGGAGACCTCGaatcaa
ggcgctgctgccggacatgctggagctgtgcgCGAGTGGGGATGCTTCTGAAAGTGAGAGCGAAAAGGCTGACGCAGAGGctcaggaagaagaggaagag
gaggagcaagaGGTTGATCTGCGCCCCAGCAGGAAACGCACGGAGCGCGCCTCTAAAAAGCGCAATGCAGTCGTGGATGcgagcgatgaagaagatgaag
aggatgacgcCAATGACAGTGATGCTAGCGAAGGCGATGCAGCTAAAcccgaagaagatgaagacgattTTGGTCCAGTTAAAAAGAGACGGACAGCGGT
ATGGGCCTCGCTTGCATATTACATGAATTGCGGTGTTACATAGTGTTTGTGCTGATAAATATGTTCGTTGTGTTTTATTGCCTGTGACTGCAGGCTGATA
TCagccacaagaagaagcgaaagagCAAGGAAGCTGTGCCACCCGCGAAAAAGTCCAAGACAGCTAAGCAGCCAGACTCGGTGGGCCTTGCTTCATTAAA
AGAACTGGGTCGCGCAGCTGGTGTTCTCAAGTATGTGTTGTGTGCTGTTTGAAATTACAACGTACTACGGTTGGTGCTAACGATCTCGATGCTTACTTGC
TGGTACTACTCAGTCCACGGTTGTACGGGCTCCTGAATGGTGCTACTTCGACTGCAGAAGCCGAGGAGATTCTGCGTGATCGCTTGCACGATGCCTGCAT
TGCTTTTCAGGGCTCGTATCCTTCGAGTCGCGATATCAGCGCCGCGAAGAGAAAGCAcgcgaaggagaaggagctggagggcATTGACACAAGCCTGATT
ATTACGGGTGGACGATCGCGTCGCGGATCAACGCTGCGCATTTCTTATAAGGAAGAACGTATCAGCGGCGAAGAAAATaacgctgaagaagaggaggaag
aagaagaagcggacgacgacgaaaagGAAGATGCTGGCGCCGAGGACTCCGCTGCCAGCGACTCAGATTCCTCGGAAGCGTCATTTTGAAGTGAAGTTCC
ACAGCTGTATCCCGGTGGCGCAAATTGCATGTGAAGTAGTAGTTGGCCCTGCTGCTAATAGAGAAAAAGGTCGCCGCCGAGAAGTGTCCATATTGGTGCA
GTTCGCCGTTGCCATGTGCTCCGATTGTCAATAGAAGTAGACTGAGGCCCACGTTGTAACCGGTTCAGGTAAGGTCTTGGCCCGGTTCAGCCCGCTTTTT
TTCTCCGCTTTTAGAGAATTGGTCACTCACGCGAGTTCGTTTAGTGACGTAATTACCGAAAAAGAGGGGTGCTAGGCCTTGGCCAGTgattggtggtggt
ggagcgcGTGGCCTTTTGGTCTTGGGGGCATTTGCCGCTCACCAGTTTCCAGAACCCGAACGTGAAGCAAGAATCATGCCGTCCTACAGCCAGGAACCTG
AAGATGCTCAGCGCGCCGCCAAGGCCCGCGGCTCGCACCTTCGCGTGCACTTTAAGCACTGCCGTGAGGTCAGCCACGCCATCAAGGGCATGCCCCTGAA
CAAGGCTAAGAGCTTCCTGCAGGCCGTGCTCGAGTACAAGCAGGCTGTGCCCTTCACCAAGTTCACGGGCGGCTGCGGCCGTCACGCTCAGGGCAAGCTC
CGCGGTGCCGCTGGCGACAAGTGCAAGTGGCCGCAGAAGGCCACCAAGATCATCCTGGACCTGGTGAAGAATGCTGAGGCTAACGCCGAGGTCAAGGGCC
TGGACACGGACTTGCTGTACATCTCGCACGCTCAGGCCAACGCCGCCATTAagcagcgtcgtcgtacCTACCGTGCTCACGGTCGCATTGGCCCCTACAT
GTCCAACCCGGCCCACATCGAGCTTATCCTGACGGAGAAGCGCGCTAATGTTGCCAAGgccgtggaggaggccaagccCACCAAGGTGTCCCGCAAGCGT
CAGGCCCAGCTGCGCCTCAAGTCGGGCGGCGGCGTCCCGGCCAACTAAGTTGCTATCCACGCACGGAGTATCTCTTGCCTGAAACACGAACGGTCAGTCG
GGAACGAGCGACTGTAGACGCGAGGGGTGGCGAAAAGTTTGGTAAACTTTTTAATACAGCCTTGGCGAGAAATGGGTTCTACTGATGCAGTGTCTGTTGC
CAAGAGAGCAAGCGCGTTTCCCAGTTCGTCTTCAATGGTGTGTCCTCGCGTGGGTCGTTGTGGTTTGCCTTGGTGCGTACAGGTACAGGTTCGGCAATCA
GCGGGACGGATAGAGGATGCTGCGACGCCAGGTGCGGATCGTGGCGTGGAAGGTGACAGCGATGAGCTGTAGTTTGCAAGCGTGGAGGGACTGGACTGGG
CGTGCTAGGAAAGCGGTGCAGTTTGCTGGACACCTATGAAGACGAGATCACTGACTACGGCGCGGCAGTTTGTAGCACTAAAGACCGAGGACAGCAAGTT
GATCCACGCCTGCAGTCGATGTCGCGACGGGAAATGGACTACCCACACTTGCAGCGTGCTCGGGTCCTGAATCGTCATCCACCACTTGACCACACCACAT
GGATCCGACTCCTCTACGGATGTGACGAGACTGATGTTGTGGAGACGCATCACGtgcttgaagttgccgtAGTGCAGGAGGTGTTGTGCTTGATCGAGGT
GCAGATGCTGTATCcgcttctgcatcttcggCAAAAAGAAGCCCACGGGCTCTTCGATGTAGAGCCACTCATTCCCTGTGGCCACGCTCTCATCTTCACT
GATGGTGCTGTCCTCTTCGCAAGTGTCAGTGTCGTGGGTCGTCTTTTGTCTAAATGGGCATAGGGACGGAAAACGCCGCCATATTGCTCCGACGCCAAGC
ATTGCGCGCTGTAGCTGCTTTTCGTAGACGTTGTTACACTGAATGCATCTTGCCAAATACATCTCTCAACGTCATTTCACTTGTTGCTCCTCAAAAAGCT
TTCGCCATGTTGAGTGGGATAAGAAACAACACGCAGGTCGTTCAAGCTACCCCCGAAATAGACCGAAAATTGAtaagctgctgcagcttaATTTCTTCAG
CTCCATGCTTTCGATCACTCGCTTCGAGCTGTATACCTGCATACACGACCAACGAAATTCCTGGTGCCAAATAAGTATCGGCGAGCTACGTCAGCTACTA
TGGCTCTCGGTCCCTCTAAGGCGCCAGTAGTTCGAGGTCGACAAGTGCAGTTGGGATTGCAATAAGCACAATCGTCTCTAGTCTTATTGCCTTGTCCTTT
GTCTTGGGCGATCACCGATGTCCAATCCAGATAGCGTTCTCTGTCCACGATGCCTCCTTTGTAATAGTACCGCCTGCGAAAAAGCTACACAGCGAAGCTT
GGTcatgttgcagcaacaatagACGTGACCTGTACTGACAAGTCGACAGAAACAGCATTCAGTATTCAAACACGACCATGGAAATCCAACTCGAGCACTT
TAAGTAGCGCCTTCTTGGAATTAAAGTGCTTGCCTGTCTTGTGTTGCTTTATGAGCAACTACAGCGCAATGACACAGCTGAAAGGCTCGGACAATCTATC
GAGGATAGCCTGAACTTCCTCAAGgagcgtcagcgtgaaggcCACTCGTAGTACACCGGTGTGGAGAAGACGGTTCCCAGTATGATCTTGGCGACGATGG
TCCGCTTTTTGACTGGGTCAAAGATTTTTTTCTAGGGGATCCGCAACTCCAGAGTTTCCGGCCACTTATTCCTGAAGGTGTGCCCGTAGACGTCGGCACT
TACAAGCCTTGTGACCCGGCTTGCTTTTTTCCTTGAACGGTGCCAGTTGTGTCCAGAGAGGAGGCAGCCCTTGGCTGTGTCTTGAGCATCTCCAGATACG
ATGCCCCCAGGTCACTTTGCATTGGCCTTGAAGATCGGGGACGGCCTTGCTCTATAGACTAAGCGACGAGAATCGGTGGCCCAGCCAGGTAGCGTCGATA
TCTCAGTAGCCCAGTAGGCTTGGATCTTGGactgccacttcaacttagTGCCAATCGAATCATGCGTTTAACATAGGATCTGAAACGAAATAATTGCGCA
AGGCAAACATATTTCCAGGCGgtgtgattggctaattAGTATTAtgctgtgattggctaattAGCATTCTGCTCAATCTCTGGACAACTTGCTCAATTGA
CCATTTATTTTGGCGGGAGTAGAGCACTTGAAAACGCGCGCATTGgcgccaagatgaagcagaagacgcagagcTCTCTGCTGAGTTTCTTCAGCCCTCC
GTCATCGAATGGCGcgtcgaccaagaagaagaagaagaacgcgccTGCTGCCTCAGACACAGACGgcagctccaagaagaaggcgtccaagacgcagacg
aagCGCGAGTCGCTGGGCAACACgcgcaagaagatcgagttCTCGCCCAAACTGAAACAGAAGACGGCAACCAAGGAGAAGGGAGACGACGGCGGTAATG
tggagatggaagacgcGGACAAGGCGTCGGCTGTGGGCGCTAAGCGCAAGGCGTACGAGGATTTCCTTGGCACAAGCTCCGAGGATGAGGGGGAGGATCC
CGTGAAGACGAGCAAAGAGAGGCCGAAGGAGGAGCCGCTGAAGAAACGTACTGGGAAAATTGTCATtcgagatgacgacgactcggaggaggaggagcct
gtagctccagcttctcgtcgtcggaaGGGGAAGACAACCACTCGTAACGTTGTGAGCAGCGAGGAGGAGTGGGGGGAGCAGGACAGCCCAGAGGAAGGGG
GCGATGAGGAAGAGTCGGAGTTTAGTGGTGCGGAGGAAGAACCTtcggatgacgacgatgtggATGATCTCGTGGAAGAGGAatcggaggaagaggccCC
GCCACCTAAGAAGCGACGTAAAAGTGCCCCTGCAGCtaccaagtcgaagaaagTGGCGGCAAAGTCCTTTTtgtctcctccacctgcggccaagaagaaa
tggAACGGCACTCCTacgtcaagcagcaagaagtcggcTGATGGTCCTGACTTGCCTAGTTCTGTGGCGGGTGCTGGCAATCATATCCATGATTCCCTGC
CTTGGCTGCACGAGAAACGACGCGACATCAATGGCAACACACCAGACTCTCCGGACTATGACCCGCGCGCTCTGACGGTACCACCAGAGTTCCTGAAAAA
GGAAACTCCGGCCATGGTGCAGTGGTGGGGAGTCAAAGCGCACAATATGGATACGGTGCTATTTTTCAAGGTTGGCAAGTTTTACGAGTTGTTTCACATG
GATGCCGATGTTGGCTTCAAGGAACTGAACCTCATCTACATGAAAGGCGATAAAGCCCACTCAGGCTTCCCAGAGATCGCATACTCAAAAATGTCATCCC
AACTGGTTGCGAAAGGCTATCGCGTCGCTCGTGTTGAACAAACGGAAACCCCCGACATGCTGAAGGTCCGAAACAGCACTTTAGCAAAAAAGGCAAAGGT
TGTTCGCCGTGAGATGTGCTCTTTACTGTCCATCGGTACCAATACTGTCAGCTTCCTGGATGCTCCTATTTCATCTCAAGACCAAGTATCAAAGCACCTT
CTCGCGGTTAAAGAATTTTTCGACCCTGCGCGGAAAACTGTGCGCTTCGGTGTTTGCATGGTGGATTGCTCTACTAGCGCCTTCCAATTATCCGAGTTTG
ACGATACGGAGCAGCGCGACCGTCTAAAGACGCTTTTCGCTCAATTCCATATCGTGGAAATCGTGACTGAGCGATTTAACATCTCGGACGACACGAAAAT
GGTGCTCAAGCACGCCGCACCTACTGCAATTCGGTCATCATTGCGAGTGGGAAAGGAGTTTTGGGATGCACCGAAAACCATCGATGAAATCGAGCGCGCA
GGGTATTTCAAGGAGCACGGGTGGCCAGAAGAGTTACTTTACTTCCTCGAAATGGATAAAGTTGTGAAGCCTGAGGGTCAACTCGTAATCAGTGCTCTGG
GCGGTTGCATTTGGCACCTGCGACGCAGTATCATTGACCAAGAGCTACTTTCACTCTGCAACTTTAACAGGTACAAGCCTTCAGATGAGGAAGCACAGGA
TGCGCGCGCAAACAAATCGGCGTTATCCACTGCTAAGGCTGAGTTGAATCAGCGATATGTCGTACTGGACTCGCAGACTATCCAGAATCTGGAGGTGCTT
TCGAATAGCTTTAACGGCTCACGCTCGGGATCACTTATCGATATCATGGACAAGACCGTGACAAGCTTTGGCCGCCGCATGTTCCAGGAGTGGGTACTTA
AACCTTTGTGCAAAACAGGCGATATTCAAGAGCGACTCGATGCTGTTGAAGAATTGGGTAATAGTGGTGACTTGATGATGGAGATCCGCGAGTTCCTCCG
CAAATTGCCGGACCTGGAACGTTTGTTGTCTCGAATTCACGCACTCGGATCTGCATATCGTTCGAAGGAGCACCCGGACAGCCGTGCAATTATGTACGAG
TCCCAGCAGTACAACGTTCGCAAGATTAAAGACTTCCTTTCCGTGCTTAACGGATTCGATGCGGCTATGAACCTCACCCTAGAGTTGGGACCTCGCCTCT
CGCAGTCTACTTCGCCGATTCTTCAGGCGCTTTTGAAGAGGTACTGTATTGACGACGGTGTTCACCCGGACATTAAACACGGGCACTTTCCCAATCTTAC
AGAGAAGCTGGAGTTCTTCAAGCGCAGCTTTGACCAAGCTGCGGCAAAAAAGAGCGGCGTGATCGTACCTCAAGCTGGCGTTGACTCAGAGTTCGACGCA
GCTTGTGTTGACATTGCTCAGGTTGAATCTGAGCTGGCGGAGTATTTAAGCGAGCAGTGCACCGCGCTGCGGTGCCGAGAAATGTCCTACTGGGGCAAGA
AAAAGGAAGATCGCTACCAGTTGGAGGTCCCCGAGAGCGCACTATCGAAGCAGCCGAAAGAATACGAGCTCAAGTCTCGCAAGAAAGGTTACAAGCGCTT
CCACACTCCAACGATCCGTAGCCTGCTGAAACGTTTGGCTACTGCGGAGGGccagaaggaggaggcacTCAAAGATCAGACACGTCGCATTTTCCACAAG
TTTGATGAGGACTACAAGTACTGGATGAAAGCGGTGCAATGCCTGGCTGTACTGGACTGCTTGGTAAGTCTCGGATTACTCAGCAGCCAGAGCGAAGGAT
ACACGAAGCCCGAAGTGGTAGCAGCTAGCTCCGCGAATGGAGGAACCCCTTTCATTGATATCGAAGAGGGCGTACACCCTTGCGTTGCTGCAACCTACGA
TAGTGGCGATTTCATTCCGAATGATGCACGTCTTGGTATCGAAGGGAAGGGCCAAATGGTTCTCCTCAGTGGACCGAACATGGGTGGTAAGTCGACGCTA
CTGCGCCAAACCTGCGTCCTGACCCTCATGGCTCAGATCGGCAGCTTCGTTCCCGCAGCAAAGTGTCGTCTTAGCCCTGTGGATCGCATTTTCACGCGAA
TTGGTGCGTCCGATCGCATCCTTGCTGGCCAGAGTACTCTTTATGTGGAGCTGGCTGAGACGGCGACGATCCTGAATCACGCGACCAGCCACTCGCTCGT
CATTCTGGACGAGTTGGGACGTGGTACCTCCACGTTCGACGGTACTGCTATCGCATACTCCGTTGTCGAGCACCTGCTGAGCGACATTCAGTGCCGGACG
ATGTTCGCGACTCACTATCACTCACTAGTTGAAGAGTACGCGTGCAACGGAAAAGTATCACTGGGTCACATGGGCTGCATCGTCGACCCGGAGAACGATC
GCAAGGTCACGTTCCTGTACAAGTTGGAGGACGGCATGTGCCCCAAGAGCTACGGTATCAACGTTGCCATGCTGGCGAAGCTTCCGGACGAAGTAATCGA
GTGCGCCGCGAAGAAGTCGGAGCAGTTCGAGCGTTCCTTGCAGGCGAACTCGCACACGGAGCTAGAGAGCGTCCGACTCGCGCAAAAGGTGAAAGAAGCG
CTAGCAGAAGGCGAAGCAGGTCTAGACAGACTCAGACAACTTTGGGAACAAGCGCGCAGTACTTGATCATAAAAAAGTGATCAATCTgaaaaatgtagcc
atgtgacgtcgctgctctGACGTCGCCTCCATACCGAAATTAAGGGAATCACCCGAAAATAAGACCATACAACGTCCAAGTCTTTCAATTGCTTCGAGAT
GAAGTCGCTCGTGGagctgtcggtggtggcCGTTGCGCTCTTCACGCCAGTGCAGGAGGTCCTCGACTATGTGGAGTACCTGCCCATCGCTATCCGCCAT
CAGCTCTTCCGCGAGCTGTCCAACTTCCGTCTGCGCGAGTTGGAGGTGGCGTGGGAGGCGGCCGCCaagctggaagcgctggaaCCGCGCGACGGCTACG
ACCCGCTAGCGGGCGACAAGTTCCTGTTCGACCGAGAGACGCAGCGAGTGTGGGAGCTCCGTATGAATGCAGCACGATTGGGCTACGAGCCGATCCCCAT
CGAGAACACGGCGGCAGCTCAGGGACGCAGACGCAACCACAGGCACGTGTTCTGGGAGCACCAGTTCcgcacgctgctcaagctgcggACGCCGCTGGAG
CTTGCAGGACCCGTGGACGTCCTGGTGGAATGCCAGAAGCTCTTTctggacgtcgtggaggtGCTCAAAATGCACGGCCGCGAGGTCTGCGACGACAATG
TGAAGCTCATCTTGGCGCTCCGACAGCTACGGAGACTGGAAGTGCACCACCCAGAACAGCAAAACACTCACTGGGAGACTATGGGACAGTTGATGCAGGA
TCATCCACATCTCACGGAGCTAGGCTTCTTCCACGGCAAGTTGAGTGACAACCAAATTGCTCAGATCCACTCCACGCTGGTGAAGCCAACCCCGACGTTG
GATAAGAGCCTGGACACCAGCAGAATCACGACGCTGGAGTTGATCTCGGTGAAAATTCGTCCTGAAGGGTATCGCCAGTTGGTGGCTCTGGTGGCTGAGA
TGCCACAGCTAACCCAGCTGAGACTGAGCAACTCCATCACGGATTTCgacacgaagctgctcatcGATGCAGCATTTCGTGCCccaaagctgcagcggct
ctTCTTGGAGCACAACGAGTTAGAAGATGACGCATTCATAGGGCTCTCGAAAATGCGAGAACCACTGGCATTACGACACCTACGCCTCAGCGACAACGAT
GTGTCGTCTACAACGGTGGGGGCGATCTGTAGCGCAAGTATGGATGGCGTGCTGAATCTGGAGCGCCTTGAATTGACGAACAACGTGCAGATCGGCGACC
CGGGTATACACGCACTGACACCAATGCTGGCTTCCCCAGGCGCTGGACCGGCTGCGGTGCTGACCTATCTGGACGTTCGTGGTTGCAATTTTGGCCTCGA
GGGTGTCACCAATTTGCTGCTAGCGCTGGGCCATAACAAGACGGTCAAGCATTTGAATGTCGCTCAAAACTTTTTCGACGTTGGTTTTGGCGATGTGCTG
GCAGATTTCCTGTTTACCAACGACTCCATCACACACTTACAAGCGAACGGCGTTGGGCTGGGGCTAGCAGGAGTGTCCGCTCGACTGTTGACGGCATTAG
TGAGCAATATCACACTCACATCTCTTTCGATGGGGGCGAATCGCTTGCGGAATGATGGTGCATCCGCTCTCCTTCGAGCACTTGTAAAGCGGGCACAGAT
AAAGCCATTCACGCTTGTCGATATGAGTGGGAACTTACTCACATTGAGCGGGCTTGCGGTGATAGCAGACATATTGAATAGCCCCACCAACGGCAACGCT
ACATACTCCGACAGCTCCCAAAGCGATAGAAtcgacggacgaggagaagctgcactgtTCGACCGGAAGCGCAGACGTACCAAGAGCTCTGACAAGCGCC
AAAACTCATTGAGTCCGcgcaacaccaacagcaaactAATCGAAGAACTGTGTCTGCTGAATAACGACTTCATCGGGAACGACGAACATGTGGGTGATAA
ATCGACGCTAATCGAGTCCATCCGATGCCGCGTGGGCCATCTCAAGAGCAACGAGTGGGCAATACAGCACCAAGTGTATGATGATGAAGTGTAGAATACA
TGGACTGAAACTCAATTTGTACCCTAGCGTCCTGAGGAATTCGTTCACATCACAATTGTGATGCCCAAAACACAAGAGTTTATCCACAATGCACCAAAAC
GCAGTAGCATGAGTGACTACACGGAATAGTTGGAATTGAAATTCTTCGGACAGCACCTACGTCCAACGAACAGCAGGCAAGACCCTTACCACTACAGCAT
TACACGATACTTGTTTCACCTCGATTTCCCATCTACCTCTCTGAGGCAAATGATTGCATTGTCATTTGAATGCCGTATTCACGGTCGGCATTGGGGCGTT
GGCGCCAGTCACGATCTTCCTTTTGCTCGATGAGTACGCGCTGCTTTTCTTGTAGTTCAGCGATATGCGAATCCAAAGAGTTGAGTATGCTCTGAAGCGG
ATGAGGGGTTTCCTCAAGCTCTCCATCCGAGCCAAGACTGTCAACATCGGCCGGTGGCTcatcatcagcgtcgtcactctggtcatcgtcatcctctcct
ccgtcgtaacattcgtcttcttcatcgccatcgccatcaccgtcatcgtcatcatcgtcatcatcgtcatcgtcctcatTAACTTTGACCGCagtggcct
tcttctcatcCAGCCGGCGCTTTTTGGCAAAGCTCTTTACGTATTGCTCGTCTTTGCCCCGTTTGGACGGCTTCTTTGAGCTGTCAGAAGTAAATTGCCT
TAAGACCGTATACGGATTGTTCAAAGATGAATGGTCCTTTGTATCGTGATTGCTATTCTTCGTGTCAGACGTATTGCTCGAGCCGGACCCTGCATAAAAG
ACAAACCGGCAGACAAGATTCACGAGTTAATACGCAGATATGCGATTAGCCGGTATGACCCGATAACCACGAAGCACTACGCACAGGCGTTATCAGACGA
GTCGATCGATTGGGCATCGAGGCCGTCATCGTCCAaatcagcatcagcatcagcatcacCATCGATTCCATCGCCCCAGGTATCTTCTTTTGTGTACCGC
CAACGTATGGAAAGACAAAAAATATGAGTCGCTAAAAGAATACATCGCAACTGAAAAAGTCGACAAACCTGGACTGGATTGCTTTCCAACAGTGCTCGAA
CTGTGTTCGTCGGTGGCATCTTCATTGCCTGTTTGAGGTGTCTGAGTTGGTGACTCGAGAAGAGGGGAGTGCTCATATTCATGCTCGcactcgtcctcgt
cgatggCAGCATCCTCATTACCTGTCTGAGGAGTCTGCTGAGCTGGAGACCCGACAACTGGAGACTGATCAAGGTCGcgttcatctccatcaaCGATGAA
TTCTTCAGAGCTGCGCAGTTCGTTTGCATTTTCTTTAGTCACGTTGCGCTGCGTAGTAGCAGCGGTCGAAACAGCATCCGCTTCACTGTCAAGTGCGTGA
TCTTGCTCTTTTGTTTCTTGTTCGGTTGTCATGGACGAATTAATATCTGGTGCCGTCAAAACGAGCTTCTCGAAGCCATCTAGCGTGCCGAAGCCTACAT
GAGCACACAATAAACGTTAAGATCAGACTACGCATCGCAATTGGGCTGCCGTACTGAATGTCATACGCTGCTCAAACTGGGTCAGAAAGAATTGGGCATC
TGCGAAAAGGTCTTGAAATGTGACGCCTGCAATGGAAAAATGGTATGATTTAGCCCCACAGTGCCAAGTACTTTTAAGCAAATCCTAGCATAAAATGCAT
ACCTGGTGTCAAGCTTGCGATCTTGTAGAAGAAATCAACCAATTTGTTGGACCGGTACAGATCAATCGAGTGCTGCATGCACCGTAGCACATTGTGCACT
ACCTTCTCCGTCCATTGGCACTGCTCTGCAATATCTCGAACAAACGCCGCATAGTCGTTCGCAGGCAATGTGTTCGCTGGTGTTCTGTCTAAAGATGGCG
ACTGCGACACAGTAGCCTCCACCTTGTTACGGGGTTTGCTTGCACGAAGAGTGCTCGTTGTACTGCGCATGCTTGGAACAGGCTTGGTTGTTACCAATGG
TGCAGCACCTGGCGCTGACGGGTTCATTGGGTTTGCTTTTGAGTTCGACGTCCCACGAGCTGCCATCGTTGCTGACCGAAGCTTAGGTCGTGGTGACCAA
ATACTTTTGCTCCGTCGTTTTCTATTGCGTTCAGACGTCAGCCTAAGGCCTGTTAACCATTCACAAAGACACTTATCAGTTCAATGGTTACAAATTCTAT
CAGAGGAGCGCACGACGTACTCCGTGACTTGAGCGCTAAATATCCAAGGGCGTAGGGGTCGTTGTTATCGCGCCAGTCTTGCTCCAACGTAAATACAATG
CGGGGTAAGTAACAAGCAGCTGATCAAGTACAGCAGGTACTATAAGCAGTAGAAGCCGAATAACTTTTTACCTGCGCAAAAAATCTTGTACGCGTCTGAG
GTTGGATCAAAAACCGTCGCTGGCAAATCTAAAATTTCACAAACAACGTATTTAAGTCAAATCACATCACATCACGAAGACCCACGCAAGTAAATAGTGT
CTCGCTCGCTTACTTGCGGTGCGAACCGTTGTCGACTTGTTCAAGAACTTCTCTCTCATGTCGGCTAACTTATTCACGCATGACCCGTCCGTTCGGTCTG
ATTCATATGCGTGGGTAGAGTATACTATGTTAGCGACAACACATAACACACGGGAATGAGATCACAACGAAAGACACTTACGCAGCTTTTCGGCGACATA
GTTCACGATGTCCGAGCTCCCAGTTCGTTGAATCTGATTCGTGATTCGAACGACGAAGTCAACGAGTGTCTCCATGTCTTCAGATGACCAAAGCTTTAGA
GCCTTGCTGAACACTTCTACTTTCCCCGCTCGATGAGCAGCCGGTACGCCGGTGAAAATCTCTCTTAAAAGCTCGAGTCGCCCAGGCTCCACCCCCTTTC
GCTCTTTACagcaacacacacacgcatACGTGATAAGCCACGCACACAAATGGAATTCGAACGCAGTAACACACTTACGACATAACCGACGCTTCTTCTC
CCTTACGTAAATGTCACGAAGCGCGTAGAATTTGCTTTTCGTTTCCGCAACCGATTTGCCTGTACAATAGGAGCTGGTAAGTATGTTGCCTGGAATGCGT
CTCCATCACCGCCAGAGCAGGTGAATACTCACCCCACACTTGAATCCGCTTGAAATACACGTCCTGGCTCTCCGTAAACAATTTACGATACTGCTTGGCC
TTTTGGAGGAAGCGACTGAGCTCGTCCGGCAGCCACATTCCGCCAACCTTGTTTTCTGGCAGTTGACTGATCGATTCGTAGATGTGTTCGTAGACGTACA
CCTCTTGTCCGTTCGTCATGATAACTGCTCCCCACACGTCACACAGCCGTTCAATCAATTCACTAATACAACAACTAAAACgcagcttgctgcagccatc
TTCTAACTAACATACCGTCCGTTCGGAAGTTTCTGGTGCTCAGTCCGAGCCCAAACTGCCGCATCAGCGACCGCACCATCTCCTGAATCTCTGACGTCTC
TTTCTCTATCAATTGACGAGGCAGAAAACAACCGAAAGCCCAGCAAAAACAATATCAGCTTCAAATTCTTTTGTCAACTGTATCATTGAACGGTCTCCGA
TAGTTTCGATGGTTATTTGACGCACCGGGCAGCTCTGCGCGCACCACCTCTGCGAACTGACTGTCGGACGCGTACACGTAGTACAGCAAGTGCTTGCGGA
ggagcgacagcagctccaatACGTCCGCATCGCCCCACCCTTGCAGCCGCGCGAGCATCCTCGAGCTGATCTCGTCCCAGTTGGCCTGAAGTTGAGCAAT
TGATGTGCATGGCGCGGGGTAGGCGATCCATTAATGACCAATGTTGCTCGAATGTTGCCAGTCGTTCGAGCAACATTCAAAGCTACAAAGGGGGACGCTG
ACCAGAGTAGCTTAGGTTGCCATGTCGGACGCCGAGGAGGAGCCGAGTAACCAGCGTGCGCTGCTGATCCCCGTCAAGAACTCAAAGCAGGCGGTGGAAG
TtttcgtggacgagctgccggATGACGTCAACGACATCATCGACATCCTGCGCGCCGAGGTGGCGCCGCTCGACGTCTGGCTACAGTTCGCCGTACGTGT
CGAAAACAAACCCCCTATTTTGCTGTCAATAATAGGGAACGATCAACTTATGTCAAATTGTATTTTTGACACTATCATAGGTGGAGTACTACAATCAGGG
CCATGTGGCTCAGTTCCAGGAGATCTTGGCCGTGGCGTCGGAGCCAGGCATCGAGGTGATCTACAAAGACAACGCGTCGCGCATGTGCCGcatcaagttc
ttcatcgCCCTGGCCAGCCACTCCGTGAACGCCATGTGgaacgaggaggacgagaagaagcgggAGGCCATCTCCCAGCGTGCCGTGGGCTACTTCCAGC
GTGCCGACCGCCTggaccaccagcaccccaTGACACTCGTGGGCAAGGCGCTCATGTTCATGGCCAAGAACGAGGACGACCGTGCCGATCGCTTTATCAA
GAGTGTGCTGATCTCCAACAAGACCAACTTGCCAGCCATCCTGGGCAAGGCGCTGTTGTTGTAccgcaagaagcagtacaagGACGCCAAGAAACTGTAT
TTGGAGGCGATCAAGCTGCACCCGCGCAGTCCACAGGCTGCTAACATGCGCATGTGCTTCGCTTATTGCTGCTACCATTTGGGGGCTGTGGAGAAGGCTC
GCGGGGTGATGCGCTACACGGCGTCGCTGGATGAGACCAACGTTGACGCAGTGATTGCTAATGCGCTGTGGCAGCTGGCAAGTCAGAGTCGAGAGGAGCG
TGCGGTTAGCATCCGTGACGAAAGCTCGCGTTTTATGATGATGATCCATCACGCTCACGCTATTGACAAGACGAACCCAACGGTGCTTAACCACCTGGCA
AATCACTACTTCTCGCAGTGGATCCCGCTTCCTTGTACGGTGAGTGTGGTGCGTGGATCTGCTGTTGTGGCCACATCCAAGGACATTTCCAGCGAAATCT
CGCCGGGTCAGATTATCTGCATTGGTGACAAGTACGTTGCCTACATTAGCCGCGATGAAGATCCCGTGTCGTCGTCTGGCCTGAAGCTTGATGGTCCATA
TCGCGATGAGTCCGCGACAGCCACAAACATTGCACGAAAGGACTACGATAAGATGTTCACGCTCGCAGGAAATGCTTTTCACAGCACGAAAATCCCTGAG
ATCCGCTCGGAAAGTTGCTACCTCATGGGACGTGGTTGCCACGCACAGGGCAAGTACAAGGACGCTTACAGCTACTACTTTAACGCCGGACGACTTTGGC
CCAAATTCGTACTTCCGTGGTTTGGGCTGGCACAGATGTACTACGAGCGCAAGGAGTTCACGAAGGCTGCATCTTACATGGAAAAGGCTAACAAAGCGTA
CCCAGAAAACGTGGAAATCTTGTCGCTTCTCGGCGATGTCTACGGCAAGCTTGGCAAAAAGGATGAGgctgttgtgctgcttcGCCGTGTTGTAGAGCTG
GAACCGGGCAACGTGGAGGCCCTGATCGGCACGGCTGAATTACTTCACGCATCCCCAGAACGAAAAGACCAGATTATTGCGATCTCTTCGTACATTGCAG
CGGAAAAAGTTATGAACAATTCCTCGGAGCGCGTGCCCATGGAAGTGTACGTCAACCTAGGtgtgcttcagcaacgcgtAGGGAAGACAACTGACTCCAT
CAAGTGCTTTAAGAAGGCACTCAAACAGTTGGGGGATGATGAAAATGCTAACGAAGAAAGCAAGTCAGAGGAGGCTGACGCTCTGGCTGAGGAAGCCTCA
ACCCCCAAGCCGTCGGAGGCGAATATCACCATTCTGTACAACATGGGGCGTGTGTACGAGGAAATGGGCAACCGTGACCGTGCCAAGAAGCTCTATGATG
CAATCCTAGAAGTTTTCCCCAGATACACCGACTGTTTGCTGCGCCTGGGCTGCATGCTGCGCGATCGTGGCCAGGAGGCTGAGGCGATCAAGATGTTTGA
CAAAGTATTGGATGTAGATCCGACTTGTGCCGAGGCCTGCTTGCTACAGGGCAACATTcacctgaagaagcgcgaaTGGGTTTTTGCTCAGAAGAAGTAT
GAAAAGGTGATGGGAATGCCTGGTCTGAAGAACGACCCGTACGCATTCTTGTCCATGGGCAATATCTTTATGAGCAACCTCGGAGAGAAGAATCGTTACA
CCAAGAACATGTCGTTGAGCGAAGTGTATTACAAGAAAACGCTGGCATCGCACCCACACAATATCTACGCAGCCAACGGATTGGGCATTATGATTGCTGA
AAAGGGTAATTTCGAGCTTGCGAAACAGATTTTCTCGCAGGTGCGTGAGGCTAGCCCGGACATGCCAGATGCCTGGATTAATCTCGCGCACATTTTCGTA
GCCGAAGAGCGTTACCAGGAGGCTATCCAGCTATACACTGTGTGTCTTACCAAGTGCTACCAGGGACAGGACCTCGAGGTGCTTTTGTACCTTGCTAAAG
CTTACTACGAGTGGAAGGATTTCCCGAGCTGCATCGCCACGCTGTCACGTGGATTGCACATGTACCCAAACGACCTTCGTCTCTGGTATAACACGGGTCT
CGCCCAGGAAGACTATGCTGTGACAACGCTTGGGCAGGAAACAACTACCACACGATCTGGAAGTGGCAATGCAGTAGCTCAACATCGTACGATGGCCGAC
GTCCAGCGCGCCATCCTGGATCTGAAGCGCGCGCAGCGCATTTTCCGTTTCCTGCTTCAGCAAGCCGAAGCAACTAATAATTCCAGCTCTAGCGATAAGA
AGAAGCACCACAACAACCTACCGTTCGATAAGGAGAAGGTGTCGGACCACGAGAAGTTCTGTAGTGACACATTGACGAAGGCAAGCTATCACTTGGAGTT
TGAGCGccagaaggaggacaagcGTCGGTTGGAGATTGAAGCTCAGCGCAAGTTGCTCCGTGAGTACGAGGAACGTGTGGCGCGCGAACAGGAGGAGACA
CgcgtgaaggaggaagaCTTGCGCAAGCGCCACGATGATATTCGACTCAAGCAGGACGAACGTCTAAAGAAATTGCACGAAGGCTGGAGTGTCCGCGAGc
gtgaggaggaagagaagaaagtGGTCAAGAAGAAAGGAGGCAAAAAGCGCAAGAAAACgggcgacgaggacggcggCTTCATTGATGACGGAGAGGACGA
GTTGGATGAGGACGGCGATAACAGCATGTCGATCGAGGACATGAAGAACCGCAACGCGACCATGAAGAAATTGGTGGAGAAGCGTAACAAGCGCGCGCGT
GTGGATTCTGGCTCggaagacgagaaggacgacCCGACTGGTCTCTTTGGCTCCGACTCGAGCGACGATGAGCAGGAGGAGTCCAAGCCAACCGAAGCCG
TCAAGGATGACGATAagcctgctgcagaagatgatgCGGTAGCGGATAGCCGTGAAGCAGAGAAGAACGAGCTCTTTGGCTCTTCCTCCGATGAGGAGTA
GGATGGATCCAGGATCGAGGACTGCCCTCCCATGTCTTCTTCATAATGCTATTCTGGTTGAACTTGTTGGGTGACTTTTGTTGAAATGGGAGGCCACAGT
GTCATTCTTGCCTTTTTGAATTTGATTTTCACTTGGAGTTTGTAAGAATTTTCGGTTTCAAAAAGGCGCGCTTCGGGCTGGCGCCAAAAGTCACCCCTCC
ATTCTGAGCCAAAATGCTTCGTCATGATTGGTCAATATGCACTGGTGGTAAAAAGCGCGGGAGTCCGCACCGAGTTACAATTGCTTGGCGCGCTCTGGCC
GCCAGCCCTCTCCCTTTAGCGCGCTGCAAGCGAGCTCTTCCGCTTGTCATTTCGGATTTGGCGCTCGACCCAACAAGCGatttctccagctccacctcca
catcAGCCGCTCGTTTCTCCCCAGCCCAGCAGCTACCACTCTCCCTTCAGCAACAAACAATCAAGGATTCTTCCCGCAAGCATGGCAAAATACGACTTTT
ACGCCGTGGCGGCAGGTCGCTCCACAGGCGTCTTCACGACGTGGGCAGAGTGCGAGGCGCAAGTGAAAGGCTTCTCAGGTGCCAGGTTCAAGAAATTCAA
GTTCAACGCCGAAGCCCAAAAAttcatcgacgactacaacgaCAAACGAGGGGTCGCAGCCTCATTGGAAGACGCCTCCGCAGACAAGTCTCTGGAGCAG
CCGGAACAGGAGCTGAACCCCAAGTTCGTGGAAAACTTCGCTAAGGGTGTGAAcgtcaaggacgagaaggaggaggagcccaaGCTTGAGATGTCCGAGT
ACAAGCGCAGAGAGTTGAGCGGCGAGCTGCCGCCCGAGCCGTTCCTTGTGGAGAACCCGAACcgcttcgtgctcttccCCATTCAGGAGCACGACGTGTG
GCAGATGTACAAGAAGGCCGAGGCTTCGTTTTGGAcggccgaggagctggaccTGGTGCACGACCTCAAGGACTGGGCGAACCTCTCGGACAACGAGCGT
CACTTCGTCAAGCATGTGCTCGCCTTTTTCGCGGCCAGTGATGGCATCGTAAACGAGAACCTGGCCATGAACTTCAGCAACGAAGTGCAGGTGCCCGAGG
CTCGCTGCTTCTACGGCTTCCAGATTGCCATCGAGAACATCCACTCGGAGGTCTACTCGCTGCTCATTGACACGTACATCAAGGACGCCATTGAGAAGGA
CCACTTGCTGCGTGCCATTGAGACCATCCCGTGCGTGACGAAGAAAGCCAACTGGGCACTCAAGTGGTGCGACCCACGTGTGTCGTCATACCCGGAGCGT
CTGCTGGCGTTCGCCTCGGTGGAgggcatcttcttctcgggctccttctgctccatcttctggCTCAAGAAGCGCGGCCTCATGCCTGGTCTCAGCTTCT
CGAACGAGCTGATCAGCCGTGATGAGGGCATGCACACGGACTTCGCCTGCCTCATGTACTCCAAGCTGGTCAACAAACTGCCGGAGAGCCGTGTGCATGA
GATCGTGCGTGACGCGGTGGTGATTGAGCACGAGTTTGTGTGTGACTCGCTCCCTGTGGAGCTGATCGGCATGAACTCGGGCCTCATGTGCCAGTACATC
GAGTTCGTGGCTGACCGTCTGCTGTACTCACTGGGTGTGTCCAAGATCTACCACGTCAAGAACCCGTTCGACTGGATGGACATGATCTCTCTCCAGGGCA
AGACCAACTTTTTCGAGAAGCGTGTGGGCGAGTACTCTAAGGCTGGTGTGGGCGTCGCGGCCGAGGAGCAGGTGTTCACTCTGGACGCCGACTTCTAAGT
ATGTGACTAGTCTGAAAGGGTGTTCCGTCGTCATTCGTCGCCCGCAGCGCTCCACGTCGCGTGGTTAAAGTCTTAAGGTCGAAGCGGCAGTGTACATAAC
GTTAGCCGGCTTCGTTGCATATTTAAAAAATCTACACTTGACATCACTCAAGACCAGCAGGACCATGGCTTTTGTTAATTAACaaaaacttcaacatttg
ccacttcaacatgaagTCTTCCTTAGCACTAGGCTTTTCCTCTTCAACGTGATATTTCTTAGCACCAGGATAAATCATGTTGACAGTACGGACATTTTTG
GACCGTCTACGAGATCTATCCATGCTGGAAGACGACAACCAAAAATGGAGAAAACAAAATTATTTGCAACGTGTTACTCATCATTGCATcgacacagcag
cgtcgcctcCTCTTTCAAACGAGTAGTGCAATCGTCATGGGGAATATCGTGTTGTGTTGCAATCGTGCGTTGTGCGTTGTATGGCATACACGAGATGTAT
GCGCGGAACATCAGCCTCAGTTGAGAGGTTGTTCAGCTCGGCGAAGATATTCGTATGGCTAGAGAGATCAACACCGAAACCGATGTGTAAGGCAATTACC
CGTGTCGCTGTTGGTACTTGTGATATATTTCGTTGTGCTGTGCAATTTCTATTATACGTCGCTGAGCGTTTGCAAATGCAGGGCGGCTCTTATCCGATCG
ATGCGCCTTCGTTAGCTATACACGACTACGGCCATTTCTCTATGCCTGACTTATTTGGAGGTGGTTGGCGCCACGTACATAGAGTTCATAAAATCCATGT
TCAgcccttcgtcttcgtcatcgtcgtccatgcCGTCGATGTCGATCATGCTGCTCTCACGTGGCTGACCAGAAGAGCGTTCGCTGTAAGCTCCAACAGA
GCTGCGCGTAAACTTGTagtgcttcttctccgccgtctccgttTGGCTGGCGGGGCCATCATCGCCAGCCGGAGGCTCGCAAGCAGGCTGGTCCAAGTGT
TTCCGGCCCTCGGATGCATTTGAAGATGCAGTAGAGGAAGCCACGAAGGAGGCGAAtccttcatcgtcctcttctccttcgaTGTCGTTTTCAATGTCCT
CCTTCATGTACGTAACTGCGACGGGTgcaggcgctggtggaggcaTAACAAACTCATCGACCGAAGGGGGAGACGGCGggtcgctgctggaactggtCGA
TGAATCGCTATCGCTGTAACGCAGCTGAGACTTCATAGGGTCTTCATTGGGCGTTAGCTGCTTTGCCTGAGGGCGGGGCGGACTACGACGCTCTCGTTCG
TTGACTGTATGCTTCGTCGGACTAGCAACAGGAGGTGTGTACTTCGGGACAGTACTGCCGATGAAGCGGCCCTCCTGGTCGACAGTCATCGCGTTCGTCA
CCGGGTGGTAGTTGGTGAAGTCCTTGACGTCCATCGTATCGCGGATAGTCTCGTTTGTGGGCGATCCGCCAATAGCACTGTTTGCGGCGCCAGCTCCTGC
CACCATATCCGTCGTCAACCAGTCGCGGACGCCCGTGAAAGGGAAGCCACTGCACGTGGGGCACTTGggcgtggtggtgaaggtgtGCGAGGCCAGCAAg
gcgacgaagctgcgcagcgccttcttgcggTAGTTGATGACGACAGGCGTGACGCTCGAGAAGACGTGCTTGCGCGGGAACTCGAAAAGCCCGAGCACCT
TCTCGTAGTTGCGGCACCCGGGGCATTTCTTGTCGGTCTTGGCGAAGAAATCGATCAGCTCGTTGCGCAGCTTGAGGAACTCAGAGAAGCGGCGCGCGAC
TTCCCATACTTGGCCGGAGCGGACGTTCGTGACGCGCACGTGGTAGCGCACCTTGCCATTGTCGGACGAGTCCACTGTGGGGAGTTGCACGCGCACGAGG
CACTTTTCATCCACGCGTCCCTGGTCGCCGTTGCGCGAGTAGGCGTAGCGTAGCGTGGGTTTCATTGGGATCTTTTGTGGCTTGGCTTGGACTGTGCAGG
ATGGGGAATGGCGCATGATATGCACTCGCAGCGCATTGCACAACAACGACCAGACGTCGAGGGTTCGTAGGAGCTCCTCGAGTAAGACGCTCGAGGTTTC
AGCGGTCATCGCCGCTGATTGGTCGTATCTTGGTCCCACCCTTTGACCGTTGCTTCAGAGAGTCAGCATTTacttgggttttgtatgCTTCTAGGGTGAG
GGAAGCCGGTTCATTCCACAGACTTTGTGGTTCGGCTCCGTCGGTGTGTGACGTCAGCGTTTCGCAAAATTGCTCAGAATTCGGCCTCCCACTTCGATGC
ACAAAGTATGCCGCGCAGGCAGATGCCTGCCTAATGACAGGCAGTCCAGGCTCGCGGCGATGCAGAGGAAAGGCCATTGACGTGCGTCGAGAGCAAAAGA
GGCTCGTAGACGAGCTACATGCACTGGCgtcaatacatgtaagcttaggATAGGAGATTTCTTAGCCGAGTGGTTTCGGAGACCACCGCGGCGGTGCTTG
AGCAATGCTGTCTGTTACTGACAGCTACGGGTGGACGGCAGCCGTCGGTCGGTGGATTTCTTGCATTAGTGCTGCGCGCTGtgaatgcagcagctgatga
GGCATGTCGATTGTGTTCGTAAAGCAGCACAGGCAACCCTGCGTGTCTGGGTTGCATGGGCACTGCCCAGAGGCTATCGTTGCCTGTTTTCTGGTTCGCA
TCCGCGTTGGTGCTGGGTTCGCTGCATTCGCATTCCAGCGTGCGCTAAGGCTGTGCTTCATCCGTGCAGTACCCGCTGGATACTATCCAGCACGGGCAGC
GTCACCCCAGAAGATGAGCAAGGCACATGTGGCTTCTGGTGTGCCTTGCTCATCTAGAATCCGATGCAGCGCTACGTAACGGTCATTTGGAAGTTGGTCA
AGGTGAAAATCATGGTGAGACCGTGAACTTCACGGTGAAGATCGCCGATCCGCTGGGCTGGTGTGTGGATGACAGGGCAGACTGCGAATCACCTGCGTGT
TCACCCCCATGGCGCTTCTACTGTACGATCGAAAAATTGGAGCGCTCTCTAATCCAAACATTGGCTCTGATGACGAGAGGCTCGTCTGCTATTTTAATAC
AAGCTGCTATCAAAATAATTATAATACaaggatacatgtacatgaccGCCCTTCCTGCACGACAGTTGATCGGTCACCCGAATCGTGTGTCTCGGTACCT
GCATTGCCTACAGTACCATGGGCCTCGGTAGAATTAACGTTGCGTAAGACTTTGTCGAGGCATGACAAAGTAGACGAAACGTTAATTAATACTGTAGTAG
GTTCTTGAATGGGCACAACGATGAAAGCCTTTGCCCAGCGACTCACACGCAACCTTaacgttgaagcagcaaaattAGTTCTTCAAGTGAGTCAGCACAT
GCAGACGAAGTGCATAGCTTATCAGCACCACGGTGCGTTTACATGTATCAGCATCGCGTAGTCACTTGGGACATCATTTAAAGCACCGTCGAATAGGACA
CACCGCCATCACCACAAGCGAGCGTGTTCAGAGTGCAGCGAATGC