Description :
From Genome Similarity Track
Location :
Scaffold_2368:421- 2796
Sequence
2375 bases(100 bases per row)
CTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGTGGGGATTCATCCGATCTGCGGCGAGCG
TGGTAGTATGGTCGTGCCACCGACACTCCCAATCCACTGTACTGGGTCTGGAAACGGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCCGCT
GCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGTATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTT
GCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGGTCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGAT
CCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCGTCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCA
CTGACTCCATTTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGACACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGC
AGCTTCGAAGTGCCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGAGACAGGGTCCGTGAGGCGATTACCTCGA
GCCTGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAGATCACGCGTAGGGCCTACTGGATCCCGAGCCT
TCACGTTCACAGGGGCTTCCTGAGCCTTCACGTTCACAGGGGCTTCCTGTCCTCGGATCCTCGCTCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAA
AGTCATGCGTCGTGGTTCGGACGACGTATCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGGCGCAGCTTGGCTGACCCTCGGCGACGACACCGAA
TCCATAGTGCGCGACCTTTCTCCGATGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCT
CTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCAC
CGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCGGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCG
AGATCCTTGTCGGACCAGCTCGACCTGGATCCAGCTTGGTCCTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCT
TTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTT
TGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACC
TCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTT
CCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGA
TCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTT
CCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGGGACGTGGGGA
TGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGGTCCGGGGCCTAGATCGTGG
ATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTCTGGGACGGGTTCTGGAGAATGGGAGA
CCTTAGAGGGGTAAACCCACCCAAGTAATAAAATTGGCGTTTAAACCCCTAGCGATTTTTTTCGCGCCCTTTTTAGAGAAAAAGCTCACTAGGTTGTAGG
ATCTGGCCAATGTATTATCCAGTTATCACTACCAACACTAGATTCGCAATTCCCAACCTTCTCGGAGCTCGTACG