Description :
From Genome Similarity Track
Location :
Scaffold_3718:421- 1555
Sequence
1134 bases(100 bases per row)
TTGCGGAAGATGTTGACCCAGTAGCGATACAGCGGGAACGACGCAGACGGATACTGGTGGCACAAGACGAGGAGCAGAAGTGGTTTAACATCAAGAAGGT
GCTTCAGGGCCAAGCAGAAGAGCTGAGTTACAAAGAAGCTCGAGATGCCTGGAAATATGCTGACCGGTTCGTATTGTCTGAAGACGGCGTGCTTCACTAT
CTTGGACTGAATCGTCGGTACGACCACGGTTGGCAAGAGGAGACCAAGCTGCGGCTTGCGGTACCGACAACGATGGTTCAAGAGGTCTTGCAGAACTGTC
ACGACTCGCTGGAAGGAGGACATCAAGGTGTGGTGGGAACGTTCCATCGCGTTAAGTCCGATTATTATTGGACCGGCTTGTACGCTGACGTGGAGAAGCA
TGTGAAGTCATGTCCAGATTGCAGCTCGAGTAAAAGCCGTCCGCAGCTTCGTGGATACTCACCTGGCAACGTACTAGCCGAACGACCTTTCCAGATCGCC
TCGATGGATTTTGTGATACCACTACCGAAATCTCGCAGGGGCAACACGGCGTTGCTCCTATTTCAGTGCTCGTTCACGAGATTCGTTATTGCCAAGGCTA
TGTCAGATACGACTGCACTGAGTGTTGCCCAAGTGTTCGAAGAATGTGTGTACCGACGGTTCGGAGCCCCATCATTAATAAGGCATGACCGCGACCCACG
CTTCATGAGCGAGGTTTTCCAAGCGTTCGCGGAGATGATGCAGTCAAGATCACGGGCGACTTTGAGCTATCGGCCGCAGGCTAATGGACAGCAGGAACGC
TCGGTGAAGTCGGTGATGGGTTCCGTACGGGTGTACGCGGAAGACCCTCTACAGCAAGATTGGGACGAAATCGCAGAGAAGCTGGTATTCGCTAATAATA
CTTCTCAGGACACTACAAGGAAGGAAACACCGTTCCACCTCGTTCATGGTTGGGCTGCGCAGTCGACGTTGCGAGCGATGTCGTCATCACTCAAACGAGA
ATTCGGCAAGCAGTCTCACGCACTAGCGTGGCGGCGTGAGATCAATCGACAAAATGAGGTCGCCCTCACTATGGCCAAAGATTATCTGGCTGTAGCAAAG
GAGCGAAGGGCTTAAAAGCATAATGATGCCCTGA