Description :
From Genome Similarity Track
Location :
Scaffold_211:42098- 43335
Sequence
1237 bases(100 bases per row)
GGAAGGAGGGAGAAAACCTCCTTCTCTGGATTCGAGAAGTCGAAATGGCGATGATCACCGCTATGCTGCGAACCGAGCAGCAGAAAGCTGGTCTAGCCAT
ATCAAAACTTGGCAGCAGAGCCAGAGAATGGGCTCTGACGTGTGATGCGTCTGTAGACGCCGCGTTTCCCACGTGTGATTCGCTTAAGAGACAGACGTCT
CGCGTGTTCGCACCGCCTAATCAGGCTTATCGAGTGCGTTCACGCTTCTTATCTCCCAACAAGGGAAGAAGGAGTTATCGGACTATGTACAAGAGTTGAT
AACTCTTCTTGCTGCTATACAATTGGATCCCCTTCCTGAGGAAGTCCGTGTCACCATTTTTATGGAAGGTCTCCGTACTGGGGTCGCTCGGACCGAATTT
TTTCGTGTCCACCCCTCAACCTTCGAGGAGGCTGTAGACATAGCGTTAAACGCCGAGTTTAATTTCAAAGCGGCTTGCTATGGTACGCATGATTACGCCC
AATCTTCGTTTGATAGGGTAGAGCCCATGGATGCCAGTCATGCTGATGATGACGAAGCAGAGCTTCAAGCTGTGTAACAGCAACATAACATCCGTAGATG
TTACACGTGCGGAAGCACAAAGCATCTCCGCCCCAACTGTCCAATGCGTAAACCGCGACAAAATCGGCCGAGCCGTAATACCGCCCCAAACCAGAAATCT
GGTACGGTGCGGGAAAATGTCGACTCCCAGTAGGCGCGGGGCTTTGTAGAGGCTCTAGGAGGTAGAGCGTAACAGGGACTAGCCCCACACGATCTCGTGG
ACGTTGCCACGAAACGTATATACAAGTCAGGCTTGTTGGTTGCCTCGGCAACGGGTTAAGGGATTTGGAGAGTCGTGGTCAATTTTGATTGACTTTGGGG
CATCGGGCGACTATGTCCAACGCTGGTCCCTTGAAAGAAGTCAGCAGTATGCTGAAGCGCTGAAAGCGCATAAAGGTGATGTTATCACGGTGCGTCTAGC
AACGGGGGCCCTTGTCACCATACCTAAAGTTCTGTTGAACTTAGGTGTAAAGGCTTTAGACTTTAACATCATTGAACGCTGTCTTTCCCTAGATTTGGAC
TCGATATATGATCTAATTCTCGGTACAGTCTGGCTGGAACGCCACGAGCCATGGATTGATTGGAGGTACAAGACCTTTGGCGCAACGCGCAATGTTTCTA
GTGAAGCTTTGGAGATTCATGAACCCACCTTTTCTAG